Latest reagent chemical Tenders | Government reagent chemical Tenders

CTN :42001219

29 Oct, 2025 NA

Kolkata - West Bengal

Tender For corrigendum : different types of laboratory diagnostics reagents and kits for pathology department

CTN :41897678

17 Oct, 2025 60.51 Lacs

Shimoga - Karnataka

Tender For supply of kfd rt-pcr reagents for virus diagnostic laboratory shimoga - beta actin qsy probe vic5tcaagatcattgctcctcctgagcgc3 50000picomoles, actin rp5gccgatccacacggagtact3 80000picomoles, actin fp5ggcacccagcacaatgaag3 80000picomoles, taqman fast virus 1 step master mix for qpcr catalog number 4444434 1 qty 200x5, taqman qsy probe-50nm kfdv ns5 probe 6fam atg gag agg agc gcc tga ccc g 22 bases catalog no 4482779 50000 picomoles, kfdv ns5 r1-tca tcc cca ctg acc agc at 20 bases catalog no 4304971 80000 picomoles, sequence detetction primer kfdv ns5f1 tgg aag cct ggc tga aag ag 20 bases 4304971 80000 picomoles

CTN :41819161

11 Oct, 2025 29.77 Lacs

Shimoga - Karnataka

Tender For kfd rt-pct testing rna kits and consumables for virus diagnostic lanoratory shimoga for fy-2025-26 - rna extraction manual kit pack of 250 rxn for vdl laboratory, automatic rna kit compitable for genetix biotech purifier ht 96, 24 well to be filled with reagents in 96well plastic ware for vdl laboratory, automatic rna kit compitable for genetix biotech purifier ht 96,48 well to be filled with reagents in 96well plastic ware for vdl laboratory, automatic rna kit compitable for genetix biotech purifier ht 96 96 well for vdl laboratory, automatic rna kit compitable for thermo scientific kingfisher flex 96,24 well well to be filled with reagents in 96well plastic ware for vdl laboratory, automatic rna kit compitable for thermo scientific kingfisher flex 96,48 well to be filled with reagents in 96well plastic ware for vdl laboratory, automatic rna kit compitable for thermo scientific kingfisher flex 96,96 well to be filled with reagents for vdl laboratory, small safe skin purple nitrile gloves 12inch extended cuff pack of 50 aql 1.5 astm 6319 standard gauge thickness measurements mm mil middle finger .15 5.9,palm .12 4.7, cuff.09 3.5 pack of 50 for vdl laboratory, cryo box 100 places paper for vdl laboratory, digital thermometer ilr for vdl laboratory, digital thermometer deep freezer-20 for vdl laboratory, amber color screw capped eppendorf tubes 2ml pack of 500 for vdl laboratory, te 1x buffer ph 8.0 rnase free 500ml for vdl laboratory, kim wipes lint free tissue white colour 4.4 inch x 8.4 inch 280 sheets is 1 unit for vdl laboratory, ice packs gel 20gms pack for vdl laboratory, filter tips racked low retention autoclavable with aerosal filter,universal size compatible with all micropipettes, free of detectable dnase,rnase,human dna pcr,hydrophobic polyethylene filters 10ul pack of 96 x10 box for vdl laboratory, cryochill external thread vial self standing sterile 1.8 ml pack of 1000 for vdl laboratory, permanent autoclave-resistant labels for vdl laboratory, buoffant caps- head cap(pack of 100) for vdl laboratory, ziplocks covers 5x7 in kg for vdl laboratory, ziplocks covers 8x10 in kg for vdl laboratory, cutter (paper knife) for vdl laboratory, dust pan for vdl laboratory, three bucket mopping for vdl laboratory, wet mop for vdl laboratory, dry dust control mop for vdl laboratory, hypoclorite solution5% 5ltr for vdl laboratory, disinfectctant cleaner (lyzol type)5ltr for vdl laboratory

Central Government/Public Sector

CTN :41489566

13 Oct, 2025 1.00 Crore

Noida - Uttar Pradesh

Tender For corrigendum : open tender document for e-procurement of laboratory equipment (soil, aggregates, cement, reinforcing bar, concrete test equipment, water, geo-textile and geogrid) for material testing laboratory of iahe - soil, unconfined compressive strengthcompression device with digital load frame: hydraulic proving ring, dial gauge vernier callipers, timer, oven, weighing balance, shear strength vane shear apparatus, grain size analysis as per is:2720 (part- iv)pipette apparatus (i) sampling pipette (ii) glass sedimentation tubes (iii) weighing bottles (iv) deleted (v) stirring apparatus (vi) sieves -2mm, 425umm , 75umm is sieves (vii) deleted, specific gravityhydrometer apparatus: two 1000 ml graduated cylinders, dispersing agent solution containing sodiumhexa-metaphosphate, dessicator and centimetre scale., shrinkage limit testfull set of equipments 1.) evaporating dish of porcelain, 2.) spatula and straight edge, 3.) balance-sensitive to 0.01 g minimum.4.) shrinkage dish. circular, porcelain or non-corroding metal dish, 5.) glass cup. 50-55 mm in diameter and 25 mm in height,6.) glass plates. two, 75x75 mm one plate of plain glass and the other prongs, 7.) thermostatically controlled oven,8.) wash bottle containing distilled water, 9.) graduate-glass, with capacity of 25 ml. 10.) mercury., sand equivalent value(i) graduated cylinder (ii) irrigator tube (iii) siphon assembly (iv) weighted foot assembly (v) measuring can (vi) sieve -4.75mm (vii) funnel (viii) 4- litre bottle (ix) flat pan (x) timing device (xi) sand equivalent shaker, ph test -electronic method(i) ph meter (ii) digital balance 300 gm capacity-sensitive 0.001gm (iii) 100ml glass beaker -3nos. (iv) volumetric flask-500ml -nos. (v) wash bottle-100 ml (vi) mortar with rubber covered pestle, aggregates, polished stone value (i) accelerated polish machine mounted on firm ,level and non resilient base of stone or concrete (ii) road wheel (iii) means for rotating road wheel (iv) means for bringing the surface of a rubber-tyred wheel of 20 cm diameter and 5 cm breadth to bear on the stone surface of the road wheel with a total load of 40 kg. (v) means to feed the sand and water at a uniform rate (vi ) means to feed the emery powder and water at uniform rate (vii) friction tester: is: 2386 part 4 as per specification of rrl uk (viii) 25 kg hard siliceous sand (ix) emery powder 5 kg, alkali aggregate reactivitymortar bar method: scales, weights, sieves, glass graduates, specimen moulds, mixing bowl, tamper, trowel, containers, length comparator, alkali aggregate reactivity chemical method:1. electronic balance2. pulveriser3. reaction container, reagents, glassware, petrographic examination 1. geological hammer2. petrographic microscope3. screen confirming to is sieve4. digital balance5. portable handheld cutting machine6. hand lens7. glass sides etc., deleterious material & organic impuritiessedimentation pipette: a watertight screw-topped glass jar, 1000 ml measuring cylinder, chemicals, containers, sieves, cement, soundness (autoclave apparatus)graduated glass cylinders, moulds, autoclave, length comparator, compaction (mortar cube vibrator), fineness (blaine air permeability apparatus), ph meter ( 2 in nos.), reinforcing bar (steel), reinforcing bar (steel) universal testing machine,to determine unit weight, yield strength,, proof stress, ultimate tensile strength, % elongation, bend and re-bend test, concrete test equipment, vibrating table 1mx1m(full set of equipments), needle vibrator ( 2 in nos.), permeability, dry shrinkage (shrinkage apparatus) ( 2 in nos.)(full set of equipments), air content (air entrainment meter apparatus)(full set of equipments), durability (rapid chloride ion permissibility apparatus), depth of penetration (water permeability apparatus) ( 2 in nos.)(full set of equipments), water, physical analysis of water, geo textile and geogrid, pull-out resistance of geotextile /geogrid

CTN :42090782

06 Oct, 2025 NA

Port Blair - Andaman And Nicobar Islands

Tender For supply of laboratory reagents and consumables items for directorate of health services

State Government

CTN :42078510

17 Oct, 2025 NA

Gandhinagar - Gujarat

Tender For rate contract for supply of various laboratory consumables - chemicals, plastic wares, glassware’s, certified reference materials (crms), reagents, refilling of various gases

CTN :42061046

30 Sep, 2025 NA

Daman - Gujarat

Tender For quotation for urgently required laboratory reagents at govt. hospital daman."

CTN :42061048

30 Sep, 2025 NA

Daman - Gujarat

Tender For quotation for urgently required laboratory reagents at govt. hospital daman."

Central Government/Public Sector

CTN :41830847

03 Oct, 2025 NA

Jamnagar - Gujarat

Tender For corrigendum : providing of selection of laboratories for testing of products/material - laboratory reagents; buyer to use custom filter to input technical specification of the product/material so that service provider may provide price offering accordingly; test; d-dimer,selection of laboratories for testing of products/material - laboratory reagents; buyer to use custom filter to input technical specification of the product/material so that service provider may provide price offering accordingly; test; d-dimer,selection of laboratories for testing of products/material - laboratory reagents; buyer to use custom filter to input technical specification of the product/material so that service provider may provide price offering accordingly; test; d-dimer,selection of laboratories for testing of products/material - laboratory reagents; buyer to use custom filter to input technical specification of the product/material so that service provider may provide price offering accordingly; test; d-dimer,selection of laboratories for testing of pro