Web Analytics Made Easy - StatCounter

Reagent Strips Tenders

Get complete information related to latest Reagent Strips Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Reagent Strips Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Reagent Strips Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

CTN :42001219 Due date: 29 Oct, 202529 Oct, 2025 NA
Tender For corrigendum : different types of laboratory diagnostics reagents and kits for pathology department

Central Government/Public Sector

CTN :42093017 Due date: 20 Oct, 202520 Oct, 2025 4.27 Lacs
Tender For supply of glucose anhydrous 100gm , glycine 500 g , gallic acid 500 gm , gram stains kit , giemsa stain solution 100 ml , gelatin 500g , glycerine 500ml , hydrochloric acid abt 35 pure 2 5 litre , hydrochloric acid lr 2 5 litre , highest purity anhydrous glucose 500g , hydrogen peroxide 1litre , iso amyl alcohol , iso propanol , itaq universal sybr green sepermix , kovac s reagent strips 25 strips vl , ketoglutaric acid 100g , lauryl sulphate sodium salt 500g , methyl orange indicator solution 125 ml , methyl red indicator solution 125 ml , methyl red 25g , methylene blue , methylene blue 25g , methanol hi ar 99 7 2 5ltr , methanol lr 2 5 litre , magnesium sulphate heptahydrate 500 g , menadione sodium bisulfite 25g , maleic acid 500g , mrs agar , mac conkey agar , nitric acid hi ar 68 72 2 5 litre , nitric acid lr 2 5 l , nigrosin stain 10 500ml , nitroblue tetrazolium chloride nbt 250ml , n butyl alcohol hi ar 500 ml , nuclease free water not depc treated 30ml , nutrient agar , oxalic acid extrapure hi ar 99 5 500g , orthophosphoric acid lr 500 ml , perchloric acid 70 hi ar 500ml , phenolphthalein indicator 1 soln in ethanol 125ml , phenolphthalein 50 g , potassium choride hi ar 99 500g , potassium chloride 500 g , potassium dihydrogen orthophosphate hi ar 99 500g , potassium dihydrogen phosphate 500g , potassium permanganate hi ar 99 500 g , potassium sulphate hi ar 99 500 g , potassium hydroxide pellets 500 g , potassium hydroxide 500g , phenol reagent hi ar folin and ciocalteu s 100ml , phenol hi ar 500g , petroleum jelly 500g , phenol red broth base , p nitrophenyl n acetyl d glucosaminide pnpg 500mg , disodium hydrogen phosphate sodium phosphate dibasic na2hpo4 500g , maltose 500g , 3 5 dinitrosalicylic acid dns 100g , chromium oxide 100g , 4 2 hydroxyethyl 1 piperazineethanesulfonic acid 100g , 8 anilinonaphthalene 1 sulfonic acid ans 5g , ouabain octahydrate 250 mg , tris hcl 500g , adenosine triphosphate atp30 g , magnesium cloride 500g , dl aspartic acid extra pure 100g , dl alanine 100g , 2 4 dinitrophenylhydrazine 2 4 dnph 100g , olive oil laboratory grade 500ml , nadph 100 mg , gum arabic acacia , sodium dihydrogen phosphate nah2po4 500g , formaldehyde solution 500 ml , bovine serum albumin 100 g , folin ciocalteu reagent 100 ml , dipotassium hydrogen phosphate potassium phosphate dibasic k2hpo4 500g , trichloroacetic acid 500 ml , glutathione reductase 100 unit , epinephrin bitartarate 1g

CTN :41819161 Due date: 11 Oct, 202511 Oct, 2025 29.77 Lacs
Tender For kfd rt-pct testing rna kits and consumables for virus diagnostic lanoratory shimoga for fy-2025-26 - rna extraction manual kit pack of 250 rxn for vdl laboratory, automatic rna kit compitable for genetix biotech purifier ht 96, 24 well to be filled with reagents in 96well plastic ware for vdl laboratory, automatic rna kit compitable for genetix biotech purifier ht 96,48 well to be filled with reagents in 96well plastic ware for vdl laboratory, automatic rna kit compitable for genetix biotech purifier ht 96 96 well for vdl laboratory, automatic rna kit compitable for thermo scientific kingfisher flex 96,24 well well to be filled with reagents in 96well plastic ware for vdl laboratory, automatic rna kit compitable for thermo scientific kingfisher flex 96,48 well to be filled with reagents in 96well plastic ware for vdl laboratory, automatic rna kit compitable for thermo scientific kingfisher flex 96,96 well to be filled with reagents for vdl laboratory, small safe skin purple nitrile gloves 12inch extended cuff pack of 50 aql 1.5 astm 6319 standard gauge thickness measurements mm mil middle finger .15 5.9,palm .12 4.7, cuff.09 3.5 pack of 50 for vdl laboratory, cryo box 100 places paper for vdl laboratory, digital thermometer ilr for vdl laboratory, digital thermometer deep freezer-20 for vdl laboratory, amber color screw capped eppendorf tubes 2ml pack of 500 for vdl laboratory, te 1x buffer ph 8.0 rnase free 500ml for vdl laboratory, kim wipes lint free tissue white colour 4.4 inch x 8.4 inch 280 sheets is 1 unit for vdl laboratory, ice packs gel 20gms pack for vdl laboratory, filter tips racked low retention autoclavable with aerosal filter,universal size compatible with all micropipettes, free of detectable dnase,rnase,human dna pcr,hydrophobic polyethylene filters 10ul pack of 96 x10 box for vdl laboratory, cryochill external thread vial self standing sterile 1.8 ml pack of 1000 for vdl laboratory, permanent autoclave-resistant labels for vdl laboratory, buoffant caps- head cap(pack of 100) for vdl laboratory, ziplocks covers 5x7 in kg for vdl laboratory, ziplocks covers 8x10 in kg for vdl laboratory, cutter (paper knife) for vdl laboratory, dust pan for vdl laboratory, three bucket mopping for vdl laboratory, wet mop for vdl laboratory, dry dust control mop for vdl laboratory, hypoclorite solution5% 5ltr for vdl laboratory, disinfectctant cleaner (lyzol type)5ltr for vdl laboratory

CTN :41897678 Due date: 17 Oct, 202517 Oct, 2025 60.51 Lacs
Tender For supply of kfd rt-pcr reagents for virus diagnostic laboratory shimoga - beta actin qsy probe vic5tcaagatcattgctcctcctgagcgc3 50000picomoles, actin rp5gccgatccacacggagtact3 80000picomoles, actin fp5ggcacccagcacaatgaag3 80000picomoles, taqman fast virus 1 step master mix for qpcr catalog number 4444434 1 qty 200x5, taqman qsy probe-50nm kfdv ns5 probe 6fam atg gag agg agc gcc tga ccc g 22 bases catalog no 4482779 50000 picomoles, kfdv ns5 r1-tca tcc cca ctg acc agc at 20 bases catalog no 4304971 80000 picomoles, sequence detetction primer kfdv ns5f1 tgg aag cct ggc tga aag ag 20 bases 4304971 80000 picomoles

Central Government/Public Sector

CTN :41489566 Due date: 13 Oct, 202513 Oct, 2025 1.00 Crore
Tender For corrigendum : open tender document for e-procurement of laboratory equipment (soil, aggregates, cement, reinforcing bar, concrete test equipment, water, geo-textile and geogrid) for material testing laboratory of iahe - soil, unconfined compressive strengthcompression device with digital load frame: hydraulic proving ring, dial gauge vernier callipers, timer, oven, weighing balance, shear strength vane shear apparatus, grain size analysis as per is:2720 (part- iv)pipette apparatus (i) sampling pipette (ii) glass sedimentation tubes (iii) weighing bottles (iv) deleted (v) stirring apparatus (vi) sieves -2mm, 425umm , 75umm is sieves (vii) deleted, specific gravityhydrometer apparatus: two 1000 ml graduated cylinders, dispersing agent solution containing sodiumhexa-metaphosphate, dessicator and centimetre scale., shrinkage limit testfull set of equipments 1.) evaporating dish of porcelain, 2.) spatula and straight edge, 3.) balance-sensitive to 0.01 g minimum.4.) shrinkage dish. circular, porcelain or non-corroding metal dish, 5.) glass cup. 50-55 mm in diameter and 25 mm in height,6.) glass plates. two, 75x75 mm one plate of plain glass and the other prongs, 7.) thermostatically controlled oven,8.) wash bottle containing distilled water, 9.) graduate-glass, with capacity of 25 ml. 10.) mercury., sand equivalent value(i) graduated cylinder (ii) irrigator tube (iii) siphon assembly (iv) weighted foot assembly (v) measuring can (vi) sieve -4.75mm (vii) funnel (viii) 4- litre bottle (ix) flat pan (x) timing device (xi) sand equivalent shaker, ph test -electronic method(i) ph meter (ii) digital balance 300 gm capacity-sensitive 0.001gm (iii) 100ml glass beaker -3nos. (iv) volumetric flask-500ml -nos. (v) wash bottle-100 ml (vi) mortar with rubber covered pestle, aggregates, polished stone value (i) accelerated polish machine mounted on firm ,level and non resilient base of stone or concrete (ii) road wheel (iii) means for rotating road wheel (iv) means for bringing the surface of a rubber-tyred wheel of 20 cm diameter and 5 cm breadth to bear on the stone surface of the road wheel with a total load of 40 kg. (v) means to feed the sand and water at a uniform rate (vi ) means to feed the emery powder and water at uniform rate (vii) friction tester: is: 2386 part 4 as per specification of rrl uk (viii) 25 kg hard siliceous sand (ix) emery powder 5 kg, alkali aggregate reactivitymortar bar method: scales, weights, sieves, glass graduates, specimen moulds, mixing bowl, tamper, trowel, containers, length comparator, alkali aggregate reactivity chemical method:1. electronic balance2. pulveriser3. reaction container, reagents, glassware, petrographic examination 1. geological hammer2. petrographic microscope3. screen confirming to is sieve4. digital balance5. portable handheld cutting machine6. hand lens7. glass sides etc., deleterious material & organic impuritiessedimentation pipette: a watertight screw-topped glass jar, 1000 ml measuring cylinder, chemicals, containers, sieves, cement, soundness (autoclave apparatus)graduated glass cylinders, moulds, autoclave, length comparator, compaction (mortar cube vibrator), fineness (blaine air permeability apparatus), ph meter ( 2 in nos.), reinforcing bar (steel), reinforcing bar (steel) universal testing machine,to determine unit weight, yield strength,, proof stress, ultimate tensile strength, % elongation, bend and re-bend test, concrete test equipment, vibrating table 1mx1m(full set of equipments), needle vibrator ( 2 in nos.), permeability, dry shrinkage (shrinkage apparatus) ( 2 in nos.)(full set of equipments), air content (air entrainment meter apparatus)(full set of equipments), durability (rapid chloride ion permissibility apparatus), depth of penetration (water permeability apparatus) ( 2 in nos.)(full set of equipments), water, physical analysis of water, geo textile and geogrid, pull-out resistance of geotextile /geogrid

CTN :42061046 Due date: 30 Sep, 202530 Sep, 2025 NA
Tender For quotation for urgently required laboratory reagents at govt. hospital daman."

CTN :42061048 Due date: 30 Sep, 202530 Sep, 2025 NA
Tender For quotation for urgently required laboratory reagents at govt. hospital daman."

State Government

CTN :42078510 Due date: 17 Oct, 202517 Oct, 2025 NA
Tender For rate contract for supply of various laboratory consumables - chemicals, plastic wares, glassware’s, certified reference materials (crms), reagents, refilling of various gases

CTN :42090782 Due date: 06 Oct, 202506 Oct, 2025 NA
Tender For supply of laboratory reagents and consumables items for directorate of health services

Central Government/Public Sector

CTN :41830847 Due date: 03 Oct, 202503 Oct, 2025 NA
Tender For corrigendum : providing of selection of laboratories for testing of products/material - laboratory reagents; buyer to use custom filter to input technical specification of the product/material so that service provider may provide price offering accordingly; test; d-dimer,selection of laboratories for testing of products/material - laboratory reagents; buyer to use custom filter to input technical specification of the product/material so that service provider may provide price offering accordingly; test; d-dimer,selection of laboratories for testing of products/material - laboratory reagents; buyer to use custom filter to input technical specification of the product/material so that service provider may provide price offering accordingly; test; d-dimer,selection of laboratories for testing of products/material - laboratory reagents; buyer to use custom filter to input technical specification of the product/material so that service provider may provide price offering accordingly; test; d-dimer,selection of laboratories for testing of pro
 Loading, Please wait...

Connect us via What's Up