Scale Softener Tenders

Get complete information related to latest Scale Softener Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Scale Softener Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Scale Softener Tenders .

Filter

Loading....

Get Tender in Email

CTN :42334710

31 Oct, 2025 NA

Udyogamandal - Kerala

Tender For tender for supply of laboratory chemcials : - calcium carbonate ar, hydrochloric acid. grade: ar/gr (pack.2.5 l, pottassium bromide ar, sodium molybdate ar, sulphuric acid.grade: ar/gr/er, cyanide standard solution, traceable to srm from nist., cyanide concentration: 1000mg/litre, salicylic acid lr, pyrogallol. grade: lr., ph buffer capsules (ph 4.0±0.05) pack containing, ph buffer capsules (ph 9.2±0.05) pack containing, ammonium acetate, grade: ar/gr, ammonium chloride, grade: ar/gr, ammonium fluoride ar/gr, ammonium molybdate-ar, boric acid, grade: ar/er/gr, ph paper, 2 to 10.5, 10 books in a packet, book containing 20 leaf each with colour chart in every book, ph buffer capsules (ph 7.0±0.05) pack containing, phenolphthalein indicator powder, grade lr, in containers of 50g, paraffin liquid.grade: ar/gr, phosphorous pentoxide.grade: ar/er/gr, sodium bicarbonate.grade: ar/gr, sodium hypochlorite containing 5-6% available chlorine, cadmium acetate dihydrate ar, minimum assay 9, ammonium hydroxide<(>,<)>, concentration: 25%, sp.gravity: 0.91, max limits of impurities: 0.01% non, volatile matter.chloride as, cl, :0.001% sulphate as so4: 0.002% arsenic as, as: 0.00002% iron as fe, :0.0001% lead as pb: 0.0001%, charcoal-activated, mono ammonium phosphate (map) 12:61:0, (100% water soluble), fertiliser grade conforming to fco.

Central Government/Public Sector

CTN :42270203

03 Nov, 2025 16.98 Lacs

Bhimtal - Uttarakhand

Tender For supply of custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5 gcggtgaagtgctcagttccc 3 22 nucleotides , ipn f 5 gtgctggccacaacgacaac 3 21 nucleotides , ipn r 5 aattggtctgccgttccta 3 19 nucleotides , isaoic f 5 ggctatctaccat aacgaat 3 21 nucleotides , isaoic r 5 gccaagtgtaagtgcactcc 3 21 nucleotides , bench top 1kb dna ladder , bench top 100bp dna ladder , bench top pcr marker , taq dna polymerase recombinant 5u ul , quick cip 1000 units with buffer , t4 dna ligase 20000 units , protoscript ii first strand cdna synthesis kit 30 reactions , q5 high fidelity 2x master mix 100 reactions , onetaq 2x master mix with standard buffer 100 reactions , synthetic peptides , spectradrop 24 kit , easy yeast plasmid isolation kit 50 rxns , quick easy yeast transformation mix 20rxn , western blot immuno booster pf 250ml , western blot blocking buffer protein free 500ml , fastdigest apai 300rxn , fastdigest bamhi 800rxn , fastdigest bgiii 100rxn , fastdigest ecori 800rxn , fastdigest ecorv eco32i 200 rxn , fastdigest hindiii 800rxn , fastdigest kpni 300rxn , fastdigest ncoi 20rxn , fastdigest ndel 100 rxn , fastdigest nhel 50 rxn , fastdigest notl 50 rxn , fastdigest saii 200rxn , fastdigest smai 100 rxn , fastdigest saci 100 rxn , fastdigest xbai 300 rxn , fastdigest xhoi 400 rxn , fastdigest value pack , synthetic peptide , mrgsh 011fw , mrgsh 011rv , shrv 1 f , shrv 1 r , shrv 2 f , shrv 2 r , shrv ipc2 fwd , shrv ipc2 rev , bacterial genome sequencing

Central Government/Public Sector

CTN :42251244

03 Nov, 2025 NA

Lucknow - Uttar Pradesh

Tender For supply of chemicals and consumables d d - l_methionine , phosphate buffer , edta , h2_o2 , borate buffer , l_phenylalanine , tri chloro acetic acid , hydrochloric acid , 2_ mercaptoethanol , 1m sodium buffer phosphate , pyrogallol , nitro_blue tetrazolium nbt chloride , pvp , riboflavin , guaiacol , triton x , tris hcl buffer , potato dextrose agar , nutrient agar , di sodium hydrogen phosphate , sodium di hydrogen phosphate , potassium hydroxide , sodium hypochlorite , lactophenol cotton blue , maxima sybr green_rox qpcr master mix 2x , revert aid first strand cdna synthesis kit , oat meal agar , streptomycin , permanent marker black , permanent marker red , micro tube racks 20 x 2ml , bluple nitrile examination gloves , non absorbent cotton wool , absorbent cotton wool , parafilm m125 , sterile disposable petri plates , disposable face masks , spatula 200 , wash bottle capacity 500ml , metaloop ch3 , thump press dispensing dropper , straight wire nichrome ) /bid number : gem/2025/b/6780307 * /dated: 11-10-2025 & & / bid document 1 / 32

Central Government/Public Sector

CTN :42149153

27 Oct, 2025 NA

Lakhimpur - Assam

Tender For tender for supply of boq bid for chemical items d d - potassium phosphate monobasic solution 1l , potassium phosphate dibasic solution 1l , pyrogallol 10g , laminarin from laminaria digitata 500mg , chitin azure 100mg , pvdf membrane filter , 0.22 um pore size-durapore , filter diam. 25 mm , hydrophilic 2 pack , curcumin 500mg , bisdemethoxycurcumin 5mg , demethoxycurcumin 5mg , hexadecyltrimethylammonium bromide 100g , canada balsam 25ml , potassium nitrate 500g , potassium sulfate 500g , calcium chloride dihydrate 500g , magnesium sulfate heptahydrate 250g , manganese(ii) chloride tetrahydrate 500g , ammonium molybdate tetrahydrate 100g , zinc sulfate heptahydrate 500g , copper(ii) sulfate pentahydrate 500g , iron(ii) sulfate heptahydrate 500g , calcium nitrate tetrahydrate 500g , ammonium sulfate 500g , sodium molybdate dihydrate 500g , boric acid 500g , manganese sulphate monohydrate 500g , ammonium dihydrogen phosphate 500g , edta , disodium salt , dihydrate 100gm , o-phenanthroline 500mg , acetone 500ml , acetonitrile , hplc 500ml , methanol 500ml , formic acid hydrazide 25g , water , hplc 1l , hydrochloric acid abt.35% pure 500ml , acetic acid glacial , 1000ml , iodine resublimed 100g , sodium carbonate anhydrous , hi-ar 100g , folin and ciocalteus phenol reagent , 100ml , sodium nitrite , hi-lr 500g , sodium hydroxide pellets 500g , l-ascorbic acid 25g , citric acid anhydrous 500g , ethyl acetate , hi-lr 2.5l , ethyl acetate , hplc 1l , petroleum ether 40 - 60 c , hi-lr 500ml , gallic acid monohydrate 500g , potassium chloride 250g , curcumin 5g , 2 , 2-diphenyl-1-picrylhydrazyl 1g , sodium sulphate anhydrous 1kg , 3 , 5-dinitrobenzoic acid , hi-ar 100g , haematoxylin (mayer) 500 ml , di-sodium hydrogen phosphate anhydrous 500g , sodium dihydrogen phosphate monohydrate 500g , sodium potassium tartrate tetrahydrate 500g , potassium iodide 100g , phenol , crystals 100g , sodium acetate anhydrous 100g , bradford reagent 100ml , d-phenylalanine 5g , corn meal dextrose agar 500ml , cycloheximide 5g , streptomycin 1pk , sterile mineral oil 500ml , czapek dox agar , modified , granulated 500g , methyl red indicator 125ml , bromothymol blue indicator 125ml , potato carrot agar 500g , v8 juice agar 500g , 2 , 3 , 5 - triphenyltetrazolium chloride 25g , kings medium b base , granulated 500g , oat meal agar 500g , hiindicator ph paper 1pk , parafilmd m250x 5no , coverslip 200no , triangular s. s. spreader with bakelite hand 10no , sterile , disposable l-spreader 50no , potassium permanganate-500g 500g , potato dextrose agar w/ chloramphenicol 500g , potato dextrose broth , granulated 500gm 500g , standard nutrient agar 500gm 500g , nutrient broth 500gm 500g , glycerol- 500 ml 500ml , sodium hypochlorite 4% 500ml (100mlx5) 500ml , chloroform 500ml 500ml , gram staining kit 2kit 1kg , copper (ii) acetate monohydrate 500g 500g , acetic acid , glacial 1000ml 1000ml , agar powder , bacteriological grade 500g 500g , sucrose 500gm 500g , d-glucose 1kg 1kg , peptone type i , bacteriological 500gm 500g , beef extract 500gm 500g , yeast extract powder , type i 500gm 500g , sodium chloride 500gm 500g , lactophenol cotton blue 500ml 500ml , agarose 1000g 1kg , fixative (buffered formalin fixative) for fixing cytological or histological samples 500ml 500ml , casamino acid (caesin acid hydrolysate) 500gm 500g , microscope immersion oil (125ml) -125g , gibberellic acid 100 gm 100g , copper (ii) sulphate anhydrous 500g 500g , d-glucose anhydrous 100g 100g , trichoderma harzianum selective agar base for selective isolation of trichoderma harzianum. 500g , chloramphenicol 3kt 3kt , rose bengal agar base , granulated 500g 500g , non absorbing cotton rolls (pack of 5) 5no , stainless steel scalpel holder no. 3 (pack of 2) 2no , sterile scalpel blade no. 10 (100 number) 100no , nichrome loop-d-4 diameter 4 mm , double wound , calibrated to 0.01ml.(5 number) 5no , metaloop ch-3x changeable nichrome loop embedded in brass rod with heat resistant handle

Central Government/Public Sector

CTN :42097865

23 Oct, 2025 NA

Panipat - Haryana

Tender For tender for supply of chemical for laboratory : : - ammonium molybdate , potassium sulphate , sodium hydroxide pellets , barium chloride , ferric chloride , pyrogallol , soda-lime (granulares) , iodine pentaoxide , potassium hydroxide pellets , p-dimethyl amino benzaldehyde , phenolphthalein indicator , urease active meal , silver nitrate , silver sulphate , potassium sodium tartrate , potassium iodide , sodium thiosulphate , tryptone , alkali blue 6-b indicator , boric acid , ferric citrate , zinc dust , cupric sulphate

Loading, Please wait...

Scale Softener Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector