Latest soyabean Tenders | Government soyabean Tenders

CTN :42250110

28 Oct, 2025 NA

Pune - Maharashtra

Tender For corrigendum : supply of aata , rice -basmati , rice -kolam , rice -jeera , badam , kaju , pista , munaka , walnut , corn flakes , oats , besan , meat masala , chhole masala , chaat masala , biryani masala , sambhar masala , pavbhaji masala , garam masala , chicken masala , mirch powder , kasuri methi , hing , pickle , custard , salt , sauff , tomato sauce , vinegar , soy sauce , chilli sauce red , chilli sauce green , biscuits-100g , groundnut oil , sunflower oil , mustard oil , desi ghee , rice noodles , pasta , coconut pdr , ragi , jam , vermicell , jaggery , makahana , black peper pdr , imlee , lawang , haldi , tej patta , small elaichi , badi elaichi , jeera whole , rai , dhaniya pdr , arhar dal , moong dal dhuli , moong whole , masoor dal , masoor whole , urad dal , urad whole , chana dal , chana kabuli , chana black , rajma , green matar , sabudana , dalia , sugar , tea , coffee , poha , sujee , maida , cornflour , magaj beej , ground nut , macaroni , mirchi whole , papad , soyabean , washing powder , hand wash , floor clean liquid , black dates , peanut butter , sattu powder , flax seeds , chia seeds , pumpkin seeds , dry cranberry , dry blue-blackberry , potato , onion , tomato , cucumber , garlic , ginger , kundru , cauliflower , capsicum , carrot , green chilly , cabbage , gavar falli cluster , parwal , green peas , beans , lady finger , pumpkin , brinjal , beet root , lockey , dodka turai , drumstick , lemon , broccoli , mushroom , bell pepper , baby corn , dhaniya patta fresh , pudina , onion patta , methi , palak , chakwat , curry patta , arbi , muli , bitter gourd , sweet potato , coconut whole brown , chandan bathua , shepu suva dill , demsa , custard apple , banana each 150 gms , kinoo , pomegranate , papaya , orange , water melon , muskmelon , apple , mango , guava , pears , black grapes , green grapes , pineapple , litchi , chiku , milk , butter , ice cream , fresh coconut water , cream , cheese spread , cheese , paneer , sweet corn , pav bread , brown bread , chicken broiler dressed chilled , meat dressed chilled-goat , pork -frozen , buffalo meat - frozen , egg fresh-hen , fish fresh

State Government

CTN :42426866

13 Nov, 2025 26.00 Lacs

Coonoor - Tamil Nadu

Tender For supply of soyabean casein digest medium agar contact plates (90mm)

CTN :42174095

27 Oct, 2025 NA

Meerut - Uttar Pradesh

Tender For bid to ras supply of toasted soyabean

Corporations And Associations And Others

CTN :42419407

31 Oct, 2025 NA

Panchkula - Haryana

Tender For e-tenders for purchase of soyabean refined oil for hafed oil mills, rewari and narnaul.

Central Government/Public Sector

CTN :42291516

04 Nov, 2025 NA

Bhimtal - Uttarakhand

Tender For supply of solution 100mm , mem non essential amino acids solution 100x , 1n hydrochloric acid solution sterile filtered 10 x 20 ml , parafilm m sealing film 100mm 38mtr dimension mm 132x135x112 , syringe driver filters cellulose acetate hydrophilic membrane pore size 0 22um 25mm diamtere with prefilter sterile , syringe driver filters cellulose acetate hydrophilic membrane pore size 0 45um 25mm diamtere with prefilter sterile , sterifast in 500ml dispenser bottle w pump , hishield hand wash in 1 lit can pack , germitol 5 lit can pack , steriswift disinfectant wipes size 6x8 , glycerol 1 2 3 propanetriol for molecular biology , calcium chloride anhydrous cell culture tested , luria bertani agar miller , tryptone soya agar casein soyabean digest agar , tryptone soya broth soyabean casein digest medium , magnesium chloride anhydrous grade 100g molecular biology grade , polyethylene glycol average mol wt 3 350 250g , colchicine 1g , nuclease free water 10x50ml depc treated for molecular biology , glutaraldehyde solution 25 in h2o , whatman quantitative filter papers ashless grade 589 1 black ribbon circles diam 185mm pack of 100 , acetic acid glacial 100 anhydrous for analysis emsure , filter tip in rack 200ul 96 tips x 10 racks x 10 packs box , filter tip in rack 1000ul 96 tips x 6 racks x 10 packs box , serological pipette crystal grade polystyrene ps sterile individually packed 5ml pieces sleeve 1 pieces inbox 100 pieces case 400 , serological pipette crystal grade polystyrene ps sterile individually packed 10ml pieces sleeve 1 pieces inbox 100 pieces case 400 , serological pipette crystal grade polystyrene ps sterile individually packed 25ml pieces sleeve 1 pieces inbox 100 pieces case 400 , cryovial externally threaded clear total volume 1 2ml packed in 50 500 sterile , alkalinity total for 50 tests , calcium hardness for 50 tests , hardness for 50 tests , magnesium for 50 tests , nitrate for 50 tests , nitrate n for 50 tests , nitrate nano2 for 50 tests , ph phenol red for 50 tests , phosphate lr for 50 tests , potassium for 50 tests , sulfate for 50 tests , staphylococcus aureus atcc 25923 , staphylococcus aureus subsp atcc 29213 , staphylococcus aureus subsp atcc 43300 , k pneumoniae atcc 700603 , k pneumoniae atcc baa 1705 , e coli atcc 25922 , coagulase plasma from rabbit , tryptone broth w 10 nacl , baird parker agar medium , alkaline peptone water , ec broth , ampicillin dextrin agar base , potato dextrose agar , potato dextrose broth , levine eosin methylene blue agar medium , glucose peptone agar , chloramine t hydrate , oxytetracycline dihydrate , d galactose , d mannitol , d mannose , d xylose , inositol , dulcitol , l rhamnose monohydrate , d sorbitol , d raffinose pentahydrate , d trehalose dihydrate , adonitol , d salicin , d melibiose monohydrate , esculin fermentation broth , gelatin hi lr , sodium hydroxide , simon citrate agar , sm agar , sim medium , starch agar , indole nitrate medium , urea agar base , glucose of medium , phenol red broth base , mr vp medium buffered glucose broth , dnase test agar w methyl green , triple sugar iron agar , ornithine decarboxylase broth , lysine decarboxylase broth , arginine dihydrolase broth , glycerol hi ar , tryptone soya broth soyabean casein digest medium , esculin agar , muller hinton agar , gram stains kit , durham tubes , o gene ruler 1kb dna ladder , o gene ruler 100bp dna ladder plus , taq dna polymerase recombinant 5 u ul , dntp mix 10mm each , water nuclease free molecular biology grade , 6x loading dye solution , lysozyme , storage vial self standing pp with hdpe closure , cryo babies , laser cryo babies , tough tags //bid details 2 / 122 , spinwin tube conical bottom pp with hdpe closure 15 ml , slid box ps , autoclavable bags pp , sample bags ldpe , beaker pmp , beaker pp , sodium hippurate , acetone , 1 butanol , ninhydrin , tagatose , dnase test agar , nutrient gelatin agar , triple sugar iron agar , phenol red dextrose broth , phenol red sucrose broth ,

Central Government/Public Sector

CTN :42306399

05 Nov, 2025 21.34 Lacs

Bhimtal - Uttarakhand

Tender For supply of component hrp membrane substrate , 3 3 diaminobenzidine , ammonium persulfate , cobalt ii chloride , yepd broth granulated 500g , ypd yepd growth agar 500g , ypd yepd growth medium , yeast nitrogen base ynb w ammonium sulphate 100g , peptone 500g , yeast extract powder , l histidine , dextrose anhydrous hi ar acs , l glutamic acid , l methionine , l lysine hi lr , l leucine , l isoleucine , 10x tris glycine sds gel running buffer , 2 5x tris sds buffer ph 8 8 , 5x tris sds buffer ph 6 8 , 10x transfer buffer , 5x laemmli buffer , 50x tae , rna isolation , sedgewick rafter counting chamber cell , borosilicate bod bottles , borosilicate dissolved oxygen bottles , uniflo 13mm 0 2 pes s 100 pk , uniflo 13mm 0 45 pes s 100 pk , uniflo 25mm 0 45 pes s 45 pk , uniflo 25mm 0 2 pes s 45 pk , single tubes pcr 0 2 ml transparent with attached flat cap , microcentrifuge tubes pp 0 5 ml with attached cap with lid closure , microcentrifuge tubes pp 1 5 ml with attached cap with lid closure , microcentrifuge tubes pp 2 0 ml with attached cap with lid closure , microcentrifuge tubes pp 5 ml transparent , mueller hinton agar granulated 500g , mueller hinton broth 500g , glucose yeast extract agar 500g , glucose yeast extract acetate broth 500g , agar granulated bacteriological grade 500g , nutrient agar granulated , nutrient broth granulated , d glucose anhydrous , sodium chloride , xylene for histopathology 2 5l , resazurin sodium salt 5g , z 2 cl osu 100g , mtt 1g , n phenyl 1 naphthylamine 500g , propidium iodide , wizard genomic dna purification kit 100 isolations x 300ul , wizard sv gel and pcr cleanup system 50 prep , hepes molecular biology grade free acid 100g , disc3 5 3 3 dipropylthiadicarbocyanine iodide 100mg , petridish , centrifuge tube conical bottom with lid , self standing centrifuge tube with lid , cryovial with external threaded self standing sterile , cryo box pp , rack for micro tube l , rack for micro tube , universal tube rack pp , universal tube rack , 20c mini cooler with gel filled cover , 0c mini cooler with nontoxic gel , agar powder bacteriological grade , mueller hinton agar , mueller hinton broth , tryptone soya broth soyabean casein digest medium , tryptone soya agar casein soyabean digest agar soyabean casein digest agar , steriswift disinfectant wipes , polyethylene glycol mw 6000 , sterile cotton swab , 2 10ul aerosol barrier gentip , 20 200ul aerosol barrier gentip , 100 1000ul aerosol barrier gentip , wrappup alluminium foils , biosoft tissue , kimwipes , kimberly clark , ecosafe disinfectant , centrifuge tube , petri dish , syringe

Central Government/Public Sector

CTN :42330366

06 Nov, 2025 NA

Nabha - Punjab

Tender For supply of soyabean meal

CTN :42386258

27 Oct, 2025 NA

Ganjam - Odisha

Tender For supply of the following items like grocery, dress materials and bedding items, cosmetic & toilet items, office & students stationaries, school bag & slipper- rice , toordal , biri dal , chana dal , whole green gram(gota muga) , dry peas , kabuli buta , desi buta , atta , besan , dalia , chatua , sooji (bada dana) , idli sooji , chuda , refined oil(sunflower) , mustard oil , pure ghee , vanaspati , vermicelly , sugar , soyabean badi(nuetrela) , rojana badi , mandia chuna , corn flour powder , cashew nut , biriyani masala , cuminseeds (jeera) , mustard seeds , fenugreek (methi) , pickle , bisciut , dry red chilly , chat masala pd. , chicken masala , curry powder , turmeric powder , chilli powder , mudhi , tampering masala (phutana) , jeera powder , bay leaf (tej patra) , fooding soda , dhania powder , black pepper , match box , cardamom(gujurati) , raisin(kismiss) , ambula , dalchini , anasi phula , pana mahuri , tooth brush , tong. cleaner , tooth paste (50 gm) , bathing soap-100gm , washing soap-150gm , washing powder-200gm , shampoo , coconut oil , talcum powder 100gm , soap case , hair band , bindi , cold cream 50gm , vaseline 20gm , nail cutter , comb , water bottle , blue 100 ml , harpic , toilet brush , sanital acid , alpine , staplers pin (no.10-1 m) , tag , gum , file cover (good quality) , file cover 4 side , teachers attendance , students attendance , correcting fluid pen (white) camlin brand , guard file(good quality , box file , register no-1 , stamp pad (big size) , stamp pad (ink) , a4 paper xerox , marker pen , cash book , long exercise note book-rolling (172 pages) soft bound , long exercise note book-plane (172 pages) soft bound , science practical note book (172page) , graph note book-20 pages , rolled note book small (120 pages) soft bound , geometry box , white chalk-non dust , ball pen-blue , four roll note book (172 page) , duster , pencil , eraser(non dust)- , sketch pen , drawing note book , thermo cole , wax crayon colour , poster colour , student water colour tube , fevicol , drawing sheet (white)140gsm , drawing sheet (different colour)140gsm , double rolled note book soft bound , rough note book (300 pages) soft bound long , colour chalk , school bag , slippers

Central Government/Public Sector

CTN :42270203

03 Nov, 2025 16.98 Lacs

Bhimtal - Uttarakhand

Tender For supply of custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5 gcggtgaagtgctcagttccc 3 22 nucleotides , ipn f 5 gtgctggccacaacgacaac 3 21 nucleotides , ipn r 5 aattggtctgccgttccta 3 19 nucleotides , isaoic f 5 ggctatctaccat aacgaat 3 21 nucleotides , isaoic r 5 gccaagtgtaagtgcactcc 3 21 nucleotides , bench top 1kb dna ladder , bench top 100bp dna ladder , bench top pcr marker , taq dna polymerase recombinant 5u ul , quick cip 1000 units with buffer , t4 dna ligase 20000 units , protoscript ii first strand cdna synthesis kit 30 reactions , q5 high fidelity 2x master mix 100 reactions , onetaq 2x master mix with standard buffer 100 reactions , synthetic peptides , spectradrop 24 kit , easy yeast plasmid isolation kit 50 rxns , quick easy yeast transformation mix 20rxn , western blot immuno booster pf 250ml , western blot blocking buffer protein free 500ml , fastdigest apai 300rxn , fastdigest bamhi 800rxn , fastdigest bgiii 100rxn , fastdigest ecori 800rxn , fastdigest ecorv eco32i 200 rxn , fastdigest hindiii 800rxn , fastdigest kpni 300rxn , fastdigest ncoi 20rxn , fastdigest ndel 100 rxn , fastdigest nhel 50 rxn , fastdigest notl 50 rxn , fastdigest saii 200rxn , fastdigest smai 100 rxn , fastdigest saci 100 rxn , fastdigest xbai 300 rxn , fastdigest xhoi 400 rxn , fastdigest value pack , synthetic peptide , mrgsh 011fw , mrgsh 011rv , shrv 1 f , shrv 1 r , shrv 2 f , shrv 2 r , shrv ipc2 fwd , shrv ipc2 rev , bacterial genome sequencing

CTN :41987697

05 Nov, 2025 NA

Patna - Bihar

Tender For corrigendum : rate contract for supply of medicine at aiims patna - 2-octyl cyanoacrylate 0.36ml, 2-octyl cyanoacrylate 0.5ml, 2-octyl cyanoacrylate 0.5ml pen, aceclofenac 100 mg+paracetamol 325mg+serratiopeptidase 15mg, amino acid infusion 7% 250ml, amino acids(10%)with electrolytes, dextrose(15%),mct & lct fat emulsion(20%) triple chambered bag 1.5l, amino acids(10%)with electrolytes, dextrose(15%),mct & lct fat emulsion(20%) triple chambered bag 1l, amino acids(10%)with electrolytes,dextrose(15%),mct & lct fat emulsion(20%) triple chambered bag 2l, amino acids(10%)with electrolytes,dextrose(30%),mct & lct fat emulsion(20%) triple chambered bag 1.5l, amino acids(10%)with electrolytes,dextrose(30%),mct & lct fat emulsion(20%) triple chambered bag 1l, amino acids(10%)with electrolytes,dextrose(30%),mct & lct fat emulsion(20%) triple chambered bag 2l, anti-rabies immunoglobulin human 100iu, aprepitant 120mg, aprepitant 80mg, brinzolamide (1% w/v) + timolol (0.5% w/v), brinzolamide 1 % with brimonidine 0.2 % with carbomer 970 p and mannitol (bak not more than 0.003%) 5ml, budesonide 100, cefixime 200 mg + dicloxacillin 500 mg , ciprofloxacin 200mg 100ml, clobestasol 0.05% + salicylic acid 3%, conjugated typhoid vaccine, contrast - non ionic for ct / angio (loperamide) 370 mg, 50ml, contrast - non ionic for ct / angio (loperamide) 370mg 100ml, contrast-non ionic for ct(loperamide) 300mg/ml,100ml, contrast-non ionic for ct(loperamide) 300mg/ml,50ml, desflurane 240ml, dextran 40 (10%) in 0.9% normal saline 500ml, dextrose 10% 1000ml, dextrose 10% 1000ml (glass), dextrose 25% 100ml, dextrose 25% 100ml(glass), dextrose 5% 1000ml, dextrose 5% 500ml (plastic), dextrose 5% 500ml(glass), dextrose 50% 100ml, dextrose inj 5% 250ml iv fluid, dextrose normal saline 500 ml, dextrose normal saline(dns) 500ml(glass), dextrose normal saline(dns)-1000ml, electrolyte-p 500ml, electrolyte-p 500ml (glass), enteral nutrition diabetic patients 400gm, enteral nutrition for premature baby/low birth weight, erythropoetin 30000iu cartridge, erythropoetin 4000 - alpha, fat emulsion mct lct 20% 250ml, flavoxate 200mg, flowable gelatin hemostat 6cc each, dextrose 5% 500ml fluid iv, fluticasone nasal spray 100 metered dose, fondaparinux sodium 2.5mg/0.5ml, formeterol 12mcg +glycopyrrolate 25mcg rotacap, formeterol 6mcg + budesonide 400mcg rotacap, formetrol 12mcg + glycopyrolate 25mcg +budesonide 400mcg, formoterol (6mcg) + budesonide (200mcg) 120 mdi synchrobreathe, formoterol (6mcg) + fluticasone propionate (250mcg) transcaps, formula feed-preterm,lbw containing per 100ml energy-76cal,proteins-1.9gm,fat- 3.9gm, carbohydrate 8.4gm, vit d 6471u, formula feed-term containing milk solids, corn oil, minerals, vitamins, soya lecithin, soyabean oil, algal oil, freeze-dried live attenuated hepatitis a vaccine 80 iu, gluco strip (blood glucose test strip), glutamine 600mg, glycerin nad sodium chloride enema 20ml, glycine 1.5% 3 ltr, halothane 250ml inhalation, heparin low molecular wt 60mg (enoxaparine), herpes zoster vaccine, human papillomavirus vaccine, hyaluronic acid 2.5% + lidocaine hydrochloride 0.03 dermal filler, hydrocortisone enema, imipenem with closed delivery system, inactivated hepatitis a vaccine 0.5ml, infant formula with dha ara and probiotic(for upto 6 month), insulin 50/50 r/nph premixed 100u/ml 3ml (pen), insulin aspart 100 iu 3ml cartridge, insulin biphasic isophane 30/70 100u/ml 3ml (pen), insulin biphasic isophane 30/70 cartridge for pen 100u 3ml, insulin glargine 100u/ml 3ml (pen), insulin glargine cartridge for pen 100iu 3ml, insulin nph cartridge for pen 100u 3ml, insulin regular 100u cartridge for pen 3ml, insulin regular 100u/ml 3ml (pen), intratracheal natural lung surfactant 1.5ml, intratracheal pulmonary porcine natural lung surfactant 3ml, intravenous fat emulsion 20%(purified soyabean oil 50gm/250ml + purified egg phospholipid 3gm/250ml + glycerol anhydrous 5.5gm/250ml) -250ml, lactitol and isabgol granules(

Soyabean Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

Corporations And Associations And Others

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector