Bharatpur Tenders

Get complete information related to latest Bharatpur Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Bharatpur Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Bharatpur Tenders .

Filter

Loading....

Get Tender in Email

CTN :45011088

16 Jun, 2026 NA

Bharatpur - Rajasthan

Tender For bid to ras bid to ras supply of cu slag blasting sa 2.5 preparation , primer inorganic zinc silicate 65 micron x 1coat , manual or power tool st2 or st3 surface preparation , primer surface tolerant epoxy 2component 75 micron x1 coat , midcoat h.b.glassflake epoxy 200 micron x 1coat for roof , midcoat polyamide epoxy mio 100 micron x 1coat , finish 2 pack pu finish 50 micron x 2coats

Central Government/Public Sector

CTN :45557118

06 Jul, 2026 NA

Bharatpur - Rajasthan

Tender For supply of ethanol extrapure, 500 ml , tbe 10x 0.9m tris borate 0.01 edta ph8.3 , ethidium bromide solution 10mg , sodium acetate ph5.2 3m , sds 10 percentage , rnase a , water molecular grade

State Government

CTN :40156450

16 Sep, 2026 1222.86 Crore

Bharatpur - Rajasthan

Tender For corrigendum : work for construction of intake well inside chambal river including approach bridge construction of rwr including all works required for inlet inside rwr outlet system from rwr to outlet chamber wtp cwr rwph and allied works package 1 under jjm

CTN :45541596

22 Jun, 2026 15.10 Lacs

Bharatpur - Rajasthan

Tender For gram panchayat k samast gram m ghar avam vyavsaik pratisthano se kachra sangrahan avam prathakkikaran avam nali safai sahit karya gp pai

Central Government/Public Sector

CTN :45557070

06 Jul, 2026 NA

Bharatpur - Rajasthan

Tender For supply of dream taq dna polymerase 5u 500 u , taq dna polymerase 5u 500u , dntp mix 2 mm each 1 ml , na , na1

State Government

CTN :40276790

16 Sep, 2026 2386.57 Crore

Bharatpur - Rajasthan

Tender For corrigendum : work of construction of intermediate cwph at kotra baseri laying of clear water transmission main from kotra to naroli nadbai via junction 2 at naroli ips nadbai nagar ramgarh kishangarhbas tijara jairoli and bhiwadi based on ham model under jjm

State Government

CTN :40173847

16 Sep, 2026 1222.08 Crore

Bharatpur - Rajasthan

Tender For corrigendum : work of construction of cwr and block cwph at various locations for clusters laying of transfer main from block ps to block cps rising main from block cps to block esrs, construction of esrs laying of cluster distribution mains laying of village distribution pipelines, construction of vtc fhtcs in various blocks of district alwar and bharatpur including all allied works under jal jeevan mission with 10 years o and m including one year defect liability period chambal alwar project package-iii on hybrid annuity model

State Government

CTN :45537562

18 Jun, 2026 2.00 Lacs

Bharatpur - Rajasthan

Tender For consumables item - non absorbable surgical diture, sterilised needled polyamide monifilament black nylon 2-0

Central Government/Public Sector

CTN :45557047

06 Jul, 2026 NA

Bharatpur - Rajasthan

Tender For supply of cgg aag act tgc tct tct ta , gtt att tgg tgc ata taa tac ata , tca gat ccc aga aga ctt gtt aat , atg tat ata tgt gta tga atg tag tac tcg , gat ctg gat gtt cat aag g , gaggtggaagagtacggttgtg , cctcacaatttcagtcaacatcgt , gccacctcctagatgtggtcata , gtccatccaggtgtttcacg , ggcatagtattccctagaagagagataac , tgttgattcttagaatggtaaatcacag , ttgaaaatcacatgtatacatatggctt

State Government

CTN :45563672

06 Jul, 2026 4.46 Crore

Bharatpur - Rajasthan

Tender For road widening work kanni gurjar to msj collage.

Loading, Please wait...

Bharatpur Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors