Web Analytics Made Easy - StatCounter

Bhimtal Uttarakhand Tenders

Get complete information related to latest Bhimtal Uttarakhand Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Bhimtal Uttarakhand Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Bhimtal Uttarakhand Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

CTN :42292092 Due date: 24 Oct, 202524 Oct, 2025 NA
Tender For supply of jaadui pitara (ncert) (q3)

Central Government/Public Sector

CTN :42291516 Due date: 04 Nov, 202504 Nov, 2025 NA
Tender For supply of solution 100mm , mem non essential amino acids solution 100x , 1n hydrochloric acid solution sterile filtered 10 x 20 ml , parafilm m sealing film 100mm 38mtr dimension mm 132x135x112 , syringe driver filters cellulose acetate hydrophilic membrane pore size 0 22um 25mm diamtere with prefilter sterile , syringe driver filters cellulose acetate hydrophilic membrane pore size 0 45um 25mm diamtere with prefilter sterile , sterifast in 500ml dispenser bottle w pump , hishield hand wash in 1 lit can pack , germitol 5 lit can pack , steriswift disinfectant wipes size 6x8 , glycerol 1 2 3 propanetriol for molecular biology , calcium chloride anhydrous cell culture tested , luria bertani agar miller , tryptone soya agar casein soyabean digest agar , tryptone soya broth soyabean casein digest medium , magnesium chloride anhydrous grade 100g molecular biology grade , polyethylene glycol average mol wt 3 350 250g , colchicine 1g , nuclease free water 10x50ml depc treated for molecular biology , glutaraldehyde solution 25 in h2o , whatman quantitative filter papers ashless grade 589 1 black ribbon circles diam 185mm pack of 100 , acetic acid glacial 100 anhydrous for analysis emsure , filter tip in rack 200ul 96 tips x 10 racks x 10 packs box , filter tip in rack 1000ul 96 tips x 6 racks x 10 packs box , serological pipette crystal grade polystyrene ps sterile individually packed 5ml pieces sleeve 1 pieces inbox 100 pieces case 400 , serological pipette crystal grade polystyrene ps sterile individually packed 10ml pieces sleeve 1 pieces inbox 100 pieces case 400 , serological pipette crystal grade polystyrene ps sterile individually packed 25ml pieces sleeve 1 pieces inbox 100 pieces case 400 , cryovial externally threaded clear total volume 1 2ml packed in 50 500 sterile , alkalinity total for 50 tests , calcium hardness for 50 tests , hardness for 50 tests , magnesium for 50 tests , nitrate for 50 tests , nitrate n for 50 tests , nitrate nano2 for 50 tests , ph phenol red for 50 tests , phosphate lr for 50 tests , potassium for 50 tests , sulfate for 50 tests , staphylococcus aureus atcc 25923 , staphylococcus aureus subsp atcc 29213 , staphylococcus aureus subsp atcc 43300 , k pneumoniae atcc 700603 , k pneumoniae atcc baa 1705 , e coli atcc 25922 , coagulase plasma from rabbit , tryptone broth w 10 nacl , baird parker agar medium , alkaline peptone water , ec broth , ampicillin dextrin agar base , potato dextrose agar , potato dextrose broth , levine eosin methylene blue agar medium , glucose peptone agar , chloramine t hydrate , oxytetracycline dihydrate , d galactose , d mannitol , d mannose , d xylose , inositol , dulcitol , l rhamnose monohydrate , d sorbitol , d raffinose pentahydrate , d trehalose dihydrate , adonitol , d salicin , d melibiose monohydrate , esculin fermentation broth , gelatin hi lr , sodium hydroxide , simon citrate agar , sm agar , sim medium , starch agar , indole nitrate medium , urea agar base , glucose of medium , phenol red broth base , mr vp medium buffered glucose broth , dnase test agar w methyl green , triple sugar iron agar , ornithine decarboxylase broth , lysine decarboxylase broth , arginine dihydrolase broth , glycerol hi ar , tryptone soya broth soyabean casein digest medium , esculin agar , muller hinton agar , gram stains kit , durham tubes , o gene ruler 1kb dna ladder , o gene ruler 100bp dna ladder plus , taq dna polymerase recombinant 5 u ul , dntp mix 10mm each , water nuclease free molecular biology grade , 6x loading dye solution , lysozyme , storage vial self standing pp with hdpe closure , cryo babies , laser cryo babies , tough tags //bid details 2 / 122 , spinwin tube conical bottom pp with hdpe closure 15 ml , slid box ps , autoclavable bags pp , sample bags ldpe , beaker pmp , beaker pp , sodium hippurate , acetone , 1 butanol , ninhydrin , tagatose , dnase test agar , nutrient gelatin agar , triple sugar iron agar , phenol red dextrose broth , phenol red sucrose broth ,

Central Government/Public Sector

CTN :42306399 Due date: 05 Nov, 202505 Nov, 2025 21.34 Lacs
Tender For supply of component hrp membrane substrate , 3 3 diaminobenzidine , ammonium persulfate , cobalt ii chloride , yepd broth granulated 500g , ypd yepd growth agar 500g , ypd yepd growth medium , yeast nitrogen base ynb w ammonium sulphate 100g , peptone 500g , yeast extract powder , l histidine , dextrose anhydrous hi ar acs , l glutamic acid , l methionine , l lysine hi lr , l leucine , l isoleucine , 10x tris glycine sds gel running buffer , 2 5x tris sds buffer ph 8 8 , 5x tris sds buffer ph 6 8 , 10x transfer buffer , 5x laemmli buffer , 50x tae , rna isolation , sedgewick rafter counting chamber cell , borosilicate bod bottles , borosilicate dissolved oxygen bottles , uniflo 13mm 0 2 pes s 100 pk , uniflo 13mm 0 45 pes s 100 pk , uniflo 25mm 0 45 pes s 45 pk , uniflo 25mm 0 2 pes s 45 pk , single tubes pcr 0 2 ml transparent with attached flat cap , microcentrifuge tubes pp 0 5 ml with attached cap with lid closure , microcentrifuge tubes pp 1 5 ml with attached cap with lid closure , microcentrifuge tubes pp 2 0 ml with attached cap with lid closure , microcentrifuge tubes pp 5 ml transparent , mueller hinton agar granulated 500g , mueller hinton broth 500g , glucose yeast extract agar 500g , glucose yeast extract acetate broth 500g , agar granulated bacteriological grade 500g , nutrient agar granulated , nutrient broth granulated , d glucose anhydrous , sodium chloride , xylene for histopathology 2 5l , resazurin sodium salt 5g , z 2 cl osu 100g , mtt 1g , n phenyl 1 naphthylamine 500g , propidium iodide , wizard genomic dna purification kit 100 isolations x 300ul , wizard sv gel and pcr cleanup system 50 prep , hepes molecular biology grade free acid 100g , disc3 5 3 3 dipropylthiadicarbocyanine iodide 100mg , petridish , centrifuge tube conical bottom with lid , self standing centrifuge tube with lid , cryovial with external threaded self standing sterile , cryo box pp , rack for micro tube l , rack for micro tube , universal tube rack pp , universal tube rack , 20c mini cooler with gel filled cover , 0c mini cooler with nontoxic gel , agar powder bacteriological grade , mueller hinton agar , mueller hinton broth , tryptone soya broth soyabean casein digest medium , tryptone soya agar casein soyabean digest agar soyabean casein digest agar , steriswift disinfectant wipes , polyethylene glycol mw 6000 , sterile cotton swab , 2 10ul aerosol barrier gentip , 20 200ul aerosol barrier gentip , 100 1000ul aerosol barrier gentip , wrappup alluminium foils , biosoft tissue , kimwipes , kimberly clark , ecosafe disinfectant , centrifuge tube , petri dish , syringe

Central Government/Public Sector

CTN :42176144 Due date: 21 Oct, 202521 Oct, 2025 5.00 Lacs
Tender For corrigendum : supply of qualitative pcr machine (thermal cycler) (q2)

Central Government/Public Sector

CTN :42270203 Due date: 03 Nov, 202503 Nov, 2025 16.98 Lacs
Tender For supply of custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5 gcggtgaagtgctcagttccc 3 22 nucleotides , ipn f 5 gtgctggccacaacgacaac 3 21 nucleotides , ipn r 5 aattggtctgccgttccta 3 19 nucleotides , isaoic f 5 ggctatctaccat aacgaat 3 21 nucleotides , isaoic r 5 gccaagtgtaagtgcactcc 3 21 nucleotides , bench top 1kb dna ladder , bench top 100bp dna ladder , bench top pcr marker , taq dna polymerase recombinant 5u ul , quick cip 1000 units with buffer , t4 dna ligase 20000 units , protoscript ii first strand cdna synthesis kit 30 reactions , q5 high fidelity 2x master mix 100 reactions , onetaq 2x master mix with standard buffer 100 reactions , synthetic peptides , spectradrop 24 kit , easy yeast plasmid isolation kit 50 rxns , quick easy yeast transformation mix 20rxn , western blot immuno booster pf 250ml , western blot blocking buffer protein free 500ml , fastdigest apai 300rxn , fastdigest bamhi 800rxn , fastdigest bgiii 100rxn , fastdigest ecori 800rxn , fastdigest ecorv eco32i 200 rxn , fastdigest hindiii 800rxn , fastdigest kpni 300rxn , fastdigest ncoi 20rxn , fastdigest ndel 100 rxn , fastdigest nhel 50 rxn , fastdigest notl 50 rxn , fastdigest saii 200rxn , fastdigest smai 100 rxn , fastdigest saci 100 rxn , fastdigest xbai 300 rxn , fastdigest xhoi 400 rxn , fastdigest value pack , synthetic peptide , mrgsh 011fw , mrgsh 011rv , shrv 1 f , shrv 1 r , shrv 2 f , shrv 2 r , shrv ipc2 fwd , shrv ipc2 rev , bacterial genome sequencing

Central Government/Public Sector

CTN :42264711 Due date: 03 Nov, 202503 Nov, 2025 26.00 Lacs
Tender For supply of rainbow trout larval feed 0 point 3 mm pallet , rainbow trout larval feed 0 point 5 mm pallet , rainbow trout larval feed 0 point 8 mm pallet , rainbow trout nursery feed 1 point 2 mm floating pallet , rainbow trout grower feed 1 point 8 mm floating pallet , rainbow trout grower feed 3 mm floating pallet , rainbow trout grower feed 6 mm floating pallet , rainbow trout nursery feed 0 point 8 mm pallet , rainbow trout early grower feed 1 point 2 mm floating pallet , rainbow trout early grower feed 1 point 8 mm floating pallet , carp feed 4 mm floating , plastic insulated ice box , oxygen cylinder , weighing balance , drag net , hand net , hapa , polythene bag , silpoline , fish wader

Central Government/Public Sector

CTN :42263794 Due date: 23 Oct, 202523 Oct, 2025 27.0 Thousand
Tender For providing of short term cab & taxi hiring services - hatchback; local; 80kms x 10hrs,short term cab & taxi hiring services - hatchback; local; 80kms x 10hrs,short term cab & taxi hiring services - hatchback; local; 80kms x 10hrs,short term cab & taxi hiring services - hatchback; local; 80kms x 10hrs,short term cab & taxi hiring services - hatchback; local; 80kms x 10hrs,short term cab & taxi hiring services - hatchback; local; 80kms x 10hrs,short term cab & taxi hiring services - hatchback; local; 80kms x 10hrs,short term cab & taxi hiring services - hatchback; local; 80kms x 10hrs,short term cab & taxi hiring services - hatchback; local; 80kms x 10hrs,short term cab & taxi hiring services - hatchback; local; 80kms x 10hrs,short term cab & taxi hiring services - sedan; local; 80kms x 10hrs,short term cab & taxi hiring services - sedan; local; 80kms x 10hrs,short term cab & taxi hiring services - sedan; local; 80kms x 10hrs,short term cab & taxi hiring services - sedan; local; 80kms x 10hrs,short term cab & taxi hiring ser

CTN :42082237 Due date: 20 Oct, 202520 Oct, 2025 NA
Tender For corrigendum : supply of entry and mid level desktop computer (q2) , line interactive ups with avr (v2) (q2)

Central Government/Public Sector

CTN :42166740 Due date: 27 Oct, 202527 Oct, 2025 NA
Tender For supply of toner for samsung 3310 nd d205s , toner for samsung 3320 nd d203s , toner for samsung mlt d 116l or xip , toner for hp laser jet pro mfp m429dw 77a , toner for hp laser jet pro 30a , toner for hp laser jet pro 88a , toner for hp 2015 d 53a , toner for hp laser jet pro 305a ce410 and three colour set , toner for hp laser jet cp 1025 color ce 310a 4 set tonner , toner for hp ink tank wireless 419 gt 53 bk and colour cmy set of three ink , toner for hp mfp 477 dw 975 a set of four colour ink , toner for brother hl3150cdn tn bk tn-c tn-m 02 tn-y , toner for toshiba studio 2809a , toner for bizhub 195 , toner for toshiba e studio 195 t2450d-2k , canon 4010 ink black, cyan, magenta, yellow set , computer monitor

Central Government/Public Sector

CTN :42175882 Due date: 28 Oct, 202528 Oct, 2025 13.00 Lacs
Tender For supply of spectrophotometer,licenced data anlysis,instrument operating software,aio desktop,3 kva ups
 Loading, Please wait...

Connect us via What's Up