Latest boric acid Tenders | Government boric acid Tenders

State Government

CTN :39840245

29 Mar, 2025 50.00 Lacs

Dausa - Rajasthan

Tender For single sourse rate contract-, ada, , ada cali, , ada controls, , albumin, , albuminsmall system pack, , alkaline phosphatase, , alkaline phosphatase small system pack, , alkaline phosphatase, , amylase, , amylasesmall system pack, , bilirubin direct, , bilirubin direct small system pack, , bilirubin direct plus (dca), , bilirubin total, , bilirubin total small system pack, , bilirubin total plus (dca), , calcium (a), , calcium (a), , calcium (a) small system pack, , chloride, , cholesterol, , cholesterol small system pack, , ck mb, , ck mb small system pack, , ck nac, , ck nacsmall system pack, , control h (aso/rf/crp), , control l (aso/rf/crp), , creatinine - enzymatic, , creatinine - enzymatic, , creatinine - jaffe, , erba autowash - system pack, , four norm, , four norm, , erba path, , erba path, , fe 125, , ferritin, , ferritin calibrator, , ferritin control low, , ferritin control high, , gamma gt, , gamma gtsmall system pack, , glucose (god - pod), , glucose hexokinase - uv, , hba1c cali set, , hba1c con h, , hba1c con l, , hdl cholesterol with calibrator, , ldh - p, , ldh - psmall system pack, , ldl cholesterol with calibrator, , lipase xl, , lipase xl small system pack, , magnesium, , micro albumin control, , micro albumin with cal, , microprotein with cal, , microprotein with cal small system pack, , phosphorus, , phosphorus small system pack, , sgot - the, , sgot - the mini, , sgot-hl, , sgot-hl small system pack, , sgpt-el, , sgpt - el mini, , sgpt - hl, , sgpt-hl small system pack, , total protein, , total protein (two reagents), , total proteinsmall system pack, , triglycerides, , triglycerides - small system pack, , uibc 125, , urea, , urea small system pack, , uric acid, , uric acid small system pack, , xl - aso - turbilatex with calibrator (ita), , xl-autowash ac/al kit, , xl - multical, , xl-rf-turbilatex with calibrator (ita), , xl-rf-turbilatex with calibrator (ita), , xl-crp-turbilatex with calibrator (ita), , xl hba1c with cali set, , sample cup, , , , , , , , , , , , , , , , , , , , , , , , , ,

CTN :39804397

31 Mar, 2025 NA

Ponnani - Kerala

Tender For supply of lab reagents - name of reagent/consumables with equipments, albumin for bs390, alkaline phosphatase for bs390, alkaline wash solution for bs390, aso for bs390, bilirubin total for bs390, bilirubin direct for bs390, calcium for bs390, cholesterol for bs390, crp for bs390, creatinine for bs390, hdl cholesterol for bs390, glucose hexokinase for bs390, ldl cholesterol for bs390, multicalibrator for bs390, phosphorus for bs390, ra for bs390, sgot for bs390, sgpt for bs390, total protein for bs390, triglycerides, urea uv for bs390, uric acid for bs390, qc norm for bs390, qcc path for bs390, crp for mispai2 ( 30 t), aso for mispai2 ( 30 t), ra for mispai2 (30 t), hbaic for mispai2 (15 t), capillary tube ( 100 nos), sodium conditioner for innolyte plus, weekly cleaning solution for innolyte plus, glucose for merilyser ( 1 ml), urea for merilyser ( 1 ml), creatinine for merilyser (1ml), sgpt for merilyser(1ml), cholesterol for merilyser(1ml), clot activator non vacum, vacutainer needle 22 g, k3 edta tube vacum, clot activator vacum, diluent for pe 6000(20 l), rinse/cleaner for pe 6000 (10l), lyse for pe 6000 (500ml), e-z cleaner for pe 6000 (100ml), probe cleaner for pe 6000(50 ml ), esr pipette for vesmatic 20, bilirubin total for merylyser(1 ml), bilirubin direct for merylyser (1ml), qc level 1 for mindray 900i, qc level 2 for mindray 900i, qc level 3 for mindray 900i, 3.8 % sodium citrate tube( vacum), dpx (250 ml), hitachi cup, anti a (10ml), anti ab (10ml), anti a1 h lectin (5ml), anti b (10 ml), anti d(10ml), anti d igg&igm(10ml), ahg(5ml), ayres spatula, barium chloride, bbr graph lab line, bbr pen lab line, capillary tube, clot activator tube, cover slip 18*18 mm( 1no), cover slip 22*22 mm(1no), cover slip 22*40 mm(1no), dengue igg,igm&ns1 combo card test, diamond pencil, disttiled water(5l), ea 36 (125 ml), esr pipette disposible, filter paper, filter paper sheet(ordinary), fouchets reagent, harris haematoxyline stain(500ml), hav igm card test, hcv card test, giemsa stain (125 ml), malaria pan pv pf, widal card test (double barrel whole blood), streptococcal rapid antigen (card test), 100 %isopropyl alcohol(5l), k3 edta tube non vacum, lancet, liss (250 ml), lepto igm card test, microtip large, micro tip small, micro scopic slide, micro centrifuge tube(500 nos), matrix gel card(144 t), og 6 (125 ml), peadiatric k 3 edta tube, pregnancy card, urine strip multiparameter, 3.8 % sodium citrate tube( non vacum), sodium flouride tube ( non vacum), sodium nitro prusside, sodium hypochlorate (2% 5l), sterile swab, sulphur powder, sulpho salycilic acid, spot band aid, tissue roll, test tube plastic (12*75), test tube glass ( 12*75), test tube brush, tourniquet belt, thermal paper (55 mm), urine container sterile, urine container non sterile, screw capped bottile, urine strip glucose protein, urine strip glucose ketone, viral transport medium ( vtm ), xylene ( 500 ml), vdrl card test, widal slide test (20ml), aso latex, ra latex, crp latex, hematology qc(bc5130), hbsag 0.3 ng sensitivity card test

corporations/Associations/Others

CTN :39835118

16 Apr, 2025 NA

Bikaner - Rajasthan

Tender For supply of biochemistry reagents meril autoquant 200 - albumin , alkaline phosphatase , alat , asat , bilirubin total , bilirubin direct , calcium , creatinine , cholesterol , hdl cholestrol direct , ldl cholestrol direct , glucose , total protein , triglyceride , uric acid , urea , autoquant cleanzer , bionorm qc-normal , biopath qc-high , bio cal calibrator , hba1c , hba1c qc , ise cleaner , ise deproteinizer , ise conditioner , ise standard , fluid pack , sample cup

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government/Public Sector

CTN :39838138

08 Apr, 2025 NA

Solapur - Maharashtra

Tender For supply of 11727 - eye drop. boric acid 1.25% + cpm 0.01% + zinc sulph 0.12% + naphazoli ne hcl 0.056% + sod. chl. 0.05% eye drops ]

Central Government/Public Sector

CTN :39541968

29 Mar, 2025 6.00 Lacs

Bhopal - Madhya Pradesh

Tender For bid to ras supply of chemicals for soil analysis - ammonium molybdate tetrahydrate , orthophosphoric acid abt , sulfuric acid , activated charcoal , buffer capsule ph 4.0 colour of solution orange , buffer capsule, ph 7.0 colour of solution green , buffer capsule, ph 9.2 colour of solution blue , devarda alloy , edta calcium disodium salt , antimony potassium tartrate trihydrate , hydrogen peroxide , methyl red indicator solution , oxalic acid dihydrate , sodium acetate trihydrate , potassium hydroxide pellets , sodium bicarbonate , potassium dichromate , methanol , ammonium fluoride , ammonium chloride , nitric acid 69 72 perc pure , ferrous ammonium sulphate hexahydrate , ammonium acetate , nitric acid , perchloric acid , hydrofluoric acid , phenolphthalein indicator , diethylene triamine penta acetic acid dtpa , ethelynediamine tetra acetic acid , devardas alloy , fluorescein diacetate , potassium dihydrogen phosphate , triphenyl tetrazolium chloride ttc , 1 3 5 triphenyltetrazolium formazan , sodium bi carbonate , sodium chloride , potassium sodium tartrate tetrahydrate also known as rochelle salt , hydrochloric acid , calcium chloride , sodium thiosulphate , acetic acid , activated charcoal phosphorus free , ammonium metavanadate , ammonium molybdate , barium chloride , boric acid , calcon indicator , copper sulphate , ebt indicator , ferrous ammonium sulphate , gum accasia , l ascorbic acid , murexide , orthophosphoric acid , potassium permanganate , potassium sulphate , selenium metal powder , sodium hexa meta phosphate , sodium hydroxide pellets , sodium acetate , ammonium hydrogen carbonate , maleic acid , citric acid , oxalic acid , potassium dihydrogen orthophosphate anhydrous , methyl orange indicator , methyl red indicator , malic acid , gum acacia powder , guar gum powder , potassium dicromate , potassium cloride , ammonium metavandate , concentrated sulfuric acid , orthoposphoric acid , ferrous ammonium sulphote , potossium permangnate , sodium hydroxide , methyl red , bromocresol green , azomethine , standard hydrochloric acid , sodium bicorbonate , dargo g 60 activate charcol , ammonium paramolybdate , antimony potassium tartrate , ascorbic acid , potassium dihydrogen orthophocphate , calcium cloride , magnesium cloride , potassium nitrate , gum acacia , dtpa diethylenetriamine penta acitic acid , tea triethonol amine , buffer tablet ph 4.0 7.0 9.2 , microplate , ethanol

Central Government/Public Sector

CTN :39335480

28 Mar, 2025 NA

Delhi - Delhi

Tender For bid to ras supply of alp (4* 35+ 2* 18ml) , bilirubin total dsa (4* 20+ 1* 20) , urea (4* 35+ 2* 18) , creatinine (2x27+ 1x18ml) , uric acid kit 4* 40+ 2* 20ml , hba1c kit (1x40+ 1x15+ 1x200+ 2x1ml calibrator) , calcium (4* 40ml) kit , amylase kit 1* 38+ 1* 10 , specific protains calibrators (1 ml) , lipids calibrator 1ml , alt0102 (sgpt) , ast0102(sgot) , glucose kit god pod method (mr) , total cholesterol kit , triglycerides kit , hdl cholesterol kit

CTN :39651130

03 Apr, 2025 NA

Multi City - Telangana

Tender For corrigendum : procurement and supply of proprietary reagents and consumables to the government colleges/ hospitals in telangana state under rate contract for a period of 2 years-, total cholesterol, , total iron binding capacity (tibc) /uibc, , total protein, , transferrin, , trigly ceride, , urea uv, , uric acid, , 25 oh vitamin d (d2 & d3), , afp, , bhcg, , ca 125, , ac 15-3, , ac 19-9, , the, , ckmb, , cortisol, , potassium, , sgot, , sgpt, , sodium, , total cholesterol, , total iron binding capacity (tibc) /uibc, , total protein, , transferrin, , trigly ceride, , urea uv, , uric acid, , 25 oh vitamin d (d2 & d3), , afp, , bhcg, , ca 125, , ac 15-3, , ac 19-9, , the, , ckmb, , cortisol, , estradiol, , ferritin, , folate, , free psa, , fsh, , ft3, , ft4, , il6, , insulin, , lh, , progesterone, , prolactin, , pth intact, , t3, , t4, , testosterone, , total psa, , troponin i/t, , tsh, , vitamin b12, , platelet kit, , acd solution, , ct scan films 14x17 medical film, ,

CTN :39816393

15 Apr, 2025 NA

Amritsar - Punjab

Tender For supply of calcium kit , esr disposable pipette , gluco strip one touch , ketostick bott of 100 strip , albumin kit , alkaline phosphatase kit , protein kit , plastic tube riya vial , r.a factor kit of 20 test , syringe disposable plastic 2ml with needle , syringe disposable plastic 5ml with needle , uniplastin pt-inr , urea kit , uric acid kit , uristick bott of 100 strip , sgot kit , sgpt kit , widal kit , distilled water can of 5 ltr , cholesterol kit , creatinine kit , glucose kit , bilirubin kit , micro cover glass , crp kit , lancet pricking needle , urine container

CTN :39807660

07 Apr, 2025 NA

Baramulla - Jammu And Kashmir

Tender For supply of reagents and chemicals to central diagnostic laboratory - kits and consumables for fully automatic biochemistry analyzer (dirui cs-400) (dedicated system pack), alp kit (456ml) (dedicated system pack), alt kit (456ml) (dedicated system pack), ast kit (456ml) (dedicated system pack), aso kit (60 ml) (dedicated system pack), bile acids kit 40 ml (dedicated system pack), total protein kit 630 ml (dedicated system pack), albumin kit 252 ml (dedicated system pack), total bilirubin kit 300 ml (dedicated system pack), direct bilirubin kit 300 ml (dedicated system pack), gamma gt kit 456 ml (dedicated system pack), amylase kit 252 ml (dedicated system pack), lipase kit 50 ml (dedicated system pack), urea kit 456 ml (dedicated system pack), creatinine kit 240 ml (dedicated system pack), microalbumin kit 50 ml (dedicated system pack), uric acid kit 456 ml (dedicated system pack), glucose kit 300 ml (dedicated system pack), g6pd kit 100 ml (dedicated system pack), hba1c kit 40 ml (dedicated system pack), hba1c lyse 100 ml (dedicated system pack), total cholesterol kit 639 ml (dedicated system pack), triglycerides kit 630 ml (dedicated system pack), hdl-c kit 164 ml (dedicated system pack), ldl-c kit 41 ml (dedicated system pack), calcium kit 240 ml (dedicated system pack), phosphorous kit 252 ml (dedicated system pack), magnesium kit 252 ml (dedicated system pack), lactate kit 30 ml (dedicated system pack), ldh kit 100 ml (dedicated system pack), crp kit (quantitative) 60 ml (dedicated system pack), rf kit (quantitative) 60 ml (dedicated system pack), ck-nac kit 60 ml (dedicated system pack), ck-mb kit 50 ml (dedicated system pack), d-dimer kit 40 ml (dedicated system pack), iron kit 312 ml (dedicated system pack), ferritin kit 32 ml (dedicated system pack), transferrin kit 50 ml (dedicated system pack), uibc kit 125 ml (dedicated system pack), urinary protein kit 240 ml (dedicated system pack), csf protein kit 240 ml (dedicated system pack), adenosine deaminase (ada) kit 54 ml (dedicated system pack), copper kit 90 ml (dedicated system pack), ceruloplasmin kit 50 ml (dedicated system pack), cholinesterase kit 153 ml (dedicated system pack), fructosamine kit 210 ml (dedicated system pack), homocysteine kit 36 ml (dedicated system pack), c3 kit 50 ml (dedicated system pack), c4 kit 50 ml (dedicated system pack), beta microglobulin kit 50 ml (dedicated system pack), lambda chain kit 55 ml (dedicated system pack), kappa chain kit 55 ml (dedicated system pack), lipoprotein (a) kit 24 ml (dedicated system pack), alpha 1 glycoprotein kit 50 ml (dedicated system pack), anti-thrombin iii kit 50 ml (dedicated system pack), cuvettes for cs-400 (segment of 20) (dedicated system pack), halogen lamp for cs-400 (dedicated system pack), seracon n 30 ml (dedicated system pack), seracon p 30 ml (dedicated system pack), seracal 18 ml (dedicated system pack), hba1c calibrator 25 ml (dedicated system pack), crp calibrator 01 ml (dedicated system pack), rf calibrator 01 ml (dedicated system pack), alkaline detergent 02 litre (dedicated system pack), acid detergent 500 ml (dedicated system pack), antibacterial po4 free detergent 500 ml (dedicated system pack), kits and consumables for urine analysers, uro color strips (10 parameter) for abbott sd urometer 120 (100 nos), uro color strips (10 parameter) for transasia erba laura (100 nos), thermal paper for abbott sd urometer 120, calibrator strips for transasia erba laura, thermal paper for transasia erba laura, kits and consumables for electrolyte analyzer (erma el-120), solution cartridge (isepak) (system pack), thermal paper for electrolyte analyzer (erma el-120), other kits and consumables, crp kit (qualitative), rf kit (qualitative), hbsag (qualitative), hcv (qualitative), widal kit, vdrl devices, pregnancy cards (hcg), strips for glucometer (accusure), lancets for glucometer, digital hb meter, strips for digital hb meter, hydrochloric acid (concentrated), hydrochloric acid (n/10), sodium hypochl

Boric Acid Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

corporations/Associations/Others

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector