Latest boric acid Tenders | Government boric acid Tenders

Central Government/Public Sector

CTN :39541968

29 Mar, 2025 6.00 Lacs

Bhopal - Madhya Pradesh

Tender For bid to ras supply of chemicals for soil analysis - ammonium molybdate tetrahydrate , orthophosphoric acid abt , sulfuric acid , activated charcoal , buffer capsule ph 4.0 colour of solution orange , buffer capsule, ph 7.0 colour of solution green , buffer capsule, ph 9.2 colour of solution blue , devarda alloy , edta calcium disodium salt , antimony potassium tartrate trihydrate , hydrogen peroxide , methyl red indicator solution , oxalic acid dihydrate , sodium acetate trihydrate , potassium hydroxide pellets , sodium bicarbonate , potassium dichromate , methanol , ammonium fluoride , ammonium chloride , nitric acid 69 72 perc pure , ferrous ammonium sulphate hexahydrate , ammonium acetate , nitric acid , perchloric acid , hydrofluoric acid , phenolphthalein indicator , diethylene triamine penta acetic acid dtpa , ethelynediamine tetra acetic acid , devardas alloy , fluorescein diacetate , potassium dihydrogen phosphate , triphenyl tetrazolium chloride ttc , 1 3 5 triphenyltetrazolium formazan , sodium bi carbonate , sodium chloride , potassium sodium tartrate tetrahydrate also known as rochelle salt , hydrochloric acid , calcium chloride , sodium thiosulphate , acetic acid , activated charcoal phosphorus free , ammonium metavanadate , ammonium molybdate , barium chloride , boric acid , calcon indicator , copper sulphate , ebt indicator , ferrous ammonium sulphate , gum accasia , l ascorbic acid , murexide , orthophosphoric acid , potassium permanganate , potassium sulphate , selenium metal powder , sodium hexa meta phosphate , sodium hydroxide pellets , sodium acetate , ammonium hydrogen carbonate , maleic acid , citric acid , oxalic acid , potassium dihydrogen orthophosphate anhydrous , methyl orange indicator , methyl red indicator , malic acid , gum acacia powder , guar gum powder , potassium dicromate , potassium cloride , ammonium metavandate , concentrated sulfuric acid , orthoposphoric acid , ferrous ammonium sulphote , potossium permangnate , sodium hydroxide , methyl red , bromocresol green , azomethine , standard hydrochloric acid , sodium bicorbonate , dargo g 60 activate charcol , ammonium paramolybdate , antimony potassium tartrate , ascorbic acid , potassium dihydrogen orthophocphate , calcium cloride , magnesium cloride , potassium nitrate , gum acacia , dtpa diethylenetriamine penta acitic acid , tea triethonol amine , buffer tablet ph 4.0 7.0 9.2 , microplate , ethanol

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government/Public Sector

CTN :39838138

08 Apr, 2025 NA

Solapur - Maharashtra

Tender For supply of 11727 - eye drop. boric acid 1.25% + cpm 0.01% + zinc sulph 0.12% + naphazoli ne hcl 0.056% + sod. chl. 0.05% eye drops ]

CTN :39206883

28 Mar, 2025 NA

Dehradune - Uttarakhand

Tender For bid to ras supply of degarelix 80 mg inj , desidustat 50 mg tab , e d brinzolamide 1percent and timolol 0.5percent bott of 5 ml , timolol maleate 0.5percent preservative free with comod system , erythropoetin 6000iu inj , preloaded hydrophobic acrylic iol automated delievery system single use aspheric , human insulin analogue long acting basal inj 100 iu ml , amanta 100 mg tab cap , alpha ketonalague with amino acid tab , amitriptyline 25 mg tab

Central Government/Public Sector

CTN :39772518

12 Apr, 2025 NA

Koraput - Odisha

Tender For supply of boric acid

CTN :39774563

07 Apr, 2025 NA

Kalpakkam - Tamil Nadu

Tender For supply of chemicals - item 1 polyacrylamide non-ionic water soluble polymer as techspecannex attached , item 2 poly acrylic acid sodium salt as technicalspecification annexure attached , item 3 poly 4 tertbutylstyrene as technical specification annexure attached , item 4 poly hexamethylene adipamide as technical specification annexure attached , item 5 poly 4 vinylpyridine as technical specification annexure attached , item 6 pol 9 vinylcarbazole as technical specificaton annexure attached , item 7 poly ethylene terepthalate as technical specification annexure attached , item 8 poly cyclohexyl methacrylate as technical specification annexure attached , item 9 poly tert butyl methacrylate as technical specification annexure attached , item 10 poly 4 methylstyrene as technical specification annexure attached , item 11 iron ii chloride as technical specification annexure attached , item 12 iron iii chloride as technical specification annexure attached , item 13 ammonium peroxydisulfate as technical specification annexure attached , item 14 2 hydroxybenzoic acid as technical specification annexure attached , item 15 ethylenediaminetetraacetic acid as technical specification annexure attached

Central Government And Public Sector

CTN :39809411

21 Apr, 2025 NA

Angul - Odisha

Tender For supply of boric acid

CTN :39796668

25 Mar, 2025 NA

Nadia - West Bengal

Tender For supply of sulfuric acid 98% (2.5 l) , sodium hydroxide (500 g) , acet ic acid glacial 100 % (500 ml) , ascorbic acid (100 g) , hydroge n peroxide (500 ml) , potassium dichromate (500 g) , diphenylamine for synthesis (100 g) , ortho-phosphoric acid 88% (500 ml) , ammonium iron (ii) sulfate hexahydrate (500 g) , charcoal act ivated (500 g) , boric acid powder (500 g) , pot assium permanganate (500 g) , perchloric acid about 70% (500 ml) , diethylenetriaminepentacet icacid (dtpa) (250 g) , ammonium acetate (500 g) , nitric acid about 69% (500 ml) , hydrochloric acid about 37% (500 m l) , ammonium fluoride purified (500 g) , triethanolamine (500 ml) , calcium chloride dihydrate (500 g) , potassium antimony (ii i) oxide tart rate hemihydrate (250 g) , methyl red indicator (25 g) , 2-4 dinitrophenol hyd razine 97 % , ammonium chloride (500 g) , salicylic acid (500 g) , disodium-edta (500 g) , azomethine-h (1 g) , kh,po. (potassium dihydrogen phosphate) (500 g) , nh. -oxalate (ammonium oxalate) (500 g) , nh.oh (ammonium hydroxide) (500 ml) , oxalic acid (500 g) , concentrated hf (hydrofluoric acid) (500 ml) , azocarmine (25 g) , ethyl alcohol (500 ml) , magnesium oxide (500 g) , k,so. (potassium sulphate) (500 g) , cuso. (copper sulphate) (500 g) , ammonium metavanadate (100 g) , 2,6-dichloro phenol indophenol (5 g) , sodium hydroxide (500 g) , ferrous ammonium sulphate (500 g) , sodium acetate (250 g) , tris acetate buffer (100 g) , potassium iodide (250 gm)

CTN :39668047

03 Apr, 2025 NA

Bhopal - Madhya Pradesh

Tender For tender for purchasing of chemicals in controller food and drug - list of chemicals, acetonitrile, acetic acid, ammonium formate, methanol, formic acid, nitric acid, hydrogen peroxide, magnesium sulphate (anhydrous), hydrochloric acid, c18 cleaning salt, ascorbic acid, primary secondary amine, sodium accetate anhydrous, ammonium formate, ammonium hydrate, tetra butyl ammonium hydride, tetrabutyl ammonium sulphate, methyl chloride, dansyl chrodide solution, green s, ethanol, ammonium phosphate monobasic, acetic acid glacial, methylene chloride, ethyl ether, n-hexane, toluene, ethyl acetate, potassium phosphate monobasic, ortho phosphoric acid, ammonium acetate, sodium sulphate anhydrous, alchohol ethanol, acetic acid glacial, acetone (hplc), aluminium oxide (activated), amonium solution, potassium sulphate, potassium iodide, silver nitrate, alkali blue 6b, boric acid, sodium thiosulphate, eosin 2% (staining solution), calsium chloride, carbon tetrachloride, barium chloride(dihydrate), edta, erichrome black-t, furfural, orthophosphoric acid, glycerol, hydrochloric acid, isopropanol, iso-amyl alchohol, methanol(hplc), nitric acid, petroleum ether 40-60, petroleum ether 60-80, phenolphthalein, potassium permagnate, resourcenol, sucrose, sulphuric acid, tlc plate, hplc water, dyethyle ether, chloroform, amylacitate, fehling sol. a, fehling sol. b, iodine resublimed, sodium hydroxide pellets, cyclohexane, methanol, ammonium chloride, ammonium hydroxide, murxide, pattons and readers, calcium, trifluoro acetic acid, edta disodium salt(dihydrate), name of culture media/serum/ chemical, agar base, baird parker agar base, egg yolk tel emulsion(50ml/100ml per vial), bismuth sulphite agar, bhi broth, brilliiant green bile broth 2%, buffered peptone water, cooked meat medium (rc medium), carbohydrate consumption broth, decarboxylase test medium (falkow), dextrose tryptone agar, fraser broth base, fraser selective supplement, fraser supplement, emb agar, levine, hugh-leifson medium, kligler iron agar, koser citrate medium, lactobacillus mrs agar, lactose broth, lysine iron agar, macconkey agar, motility test medium, mr-vp medium, myp agar base (phenol red egg yolk polymyxin agar base), poly b selective supplement, egg yolk emulsion(50ml/100ml per vial), modified listeria oxford agar base, colcef selective supplement, nitrate broth, nutrient broth, peptone water diluent, plate count agar, listeria identification agar base (palcam), palcam selective supplement, selenite cysteine broth, sheep blood agar base, thiosulphate citrate bile salt sucrose agar(tcbs), triple sugar iron agar, tryptone broth (tryptone water), urea agar base, xylose lysine deoxycholate agar (xld agar), tryptic soy agar, violet red bile agar, perfringens agar base, tsc selective supplement, cmf selective supplement, tryptone glucose extract, thioglycolate agar, tryptone salt agar w/1% nacl, tetrathionate broth base (w/o iodine & bg), potato dextrose agar, phenol red broth base, my 40 (osmophillic agar), acetate agar, czapek yeast (autolysate) agar, 10% lactic acid solution (10 ml/vial), ec broth, gn broth, hajna, hektoen enteric agar, lauryl sulphate broth (lauryl tryptose broth), liver broth / l-broth, modified, malonate broth, malt agar, mannitol salt agar base, glucose agar, yeast extract powder, peptone, rappaport vassilidis medium, saline nutrient agar, alkaline saline peptone water, onpg broth, bolton broth base, bolton selective supplement, violet red bile glucose agar w/o lactose, iron sulphite agar, ellners broth, willis and hobb s medium, glucose of medium, tryptone bile glucuronic agar (tbx agar), tergitol-7-agar base, ttc solution 1% (10ml/vial), macconkey broth, macconkey broth purple, simmons citrate agar, macconkey sorbitol agar, tryptone soya yeast extract broth, hicrome listeria ottaviani agosti agar, oa selective supplement, lp enrichment supplement, mueller kauffman tetrathionate broth base, chromogenic coliform agar, slantz & burtley medium, bile

Private Sector

CTN :39725493

27 Mar, 2025 NA

Jhajjar - Haryana

Tender For fine chemicals - petroleum ether 60-80 deg. c, chemicals chlorotex reagent, sulphuric acid :(ar/gr/excelr), hydrochloric acid conc. ar/gr, acids:-nitric acid ar, acetone, ammonium molybdate ar/gr/excellar, ansa, ar/gr/excellar,100 gm, chemical: buffer solution of ph-4.00, chemical: buffer solution of ph-7.0, chemical: buffer solution of ph-10.0, potassium hydroxide pellets ar, boric acid ar/gr/excelar, ammonium metavandate ar/gr/excelr, sodium nitrate; ar/gr/excelar grade, sod. meta silicate lab(ar)

Boric Acid Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government And Public Sector

Private Sector