Latest boric acid Tenders | Government boric acid Tenders

Central Government/Public Sector

CTN :39541968

29 Mar, 2025 6.00 Lacs

Bhopal - Madhya Pradesh

Tender For bid to ras supply of chemicals for soil analysis - ammonium molybdate tetrahydrate , orthophosphoric acid abt , sulfuric acid , activated charcoal , buffer capsule ph 4.0 colour of solution orange , buffer capsule, ph 7.0 colour of solution green , buffer capsule, ph 9.2 colour of solution blue , devarda alloy , edta calcium disodium salt , antimony potassium tartrate trihydrate , hydrogen peroxide , methyl red indicator solution , oxalic acid dihydrate , sodium acetate trihydrate , potassium hydroxide pellets , sodium bicarbonate , potassium dichromate , methanol , ammonium fluoride , ammonium chloride , nitric acid 69 72 perc pure , ferrous ammonium sulphate hexahydrate , ammonium acetate , nitric acid , perchloric acid , hydrofluoric acid , phenolphthalein indicator , diethylene triamine penta acetic acid dtpa , ethelynediamine tetra acetic acid , devardas alloy , fluorescein diacetate , potassium dihydrogen phosphate , triphenyl tetrazolium chloride ttc , 1 3 5 triphenyltetrazolium formazan , sodium bi carbonate , sodium chloride , potassium sodium tartrate tetrahydrate also known as rochelle salt , hydrochloric acid , calcium chloride , sodium thiosulphate , acetic acid , activated charcoal phosphorus free , ammonium metavanadate , ammonium molybdate , barium chloride , boric acid , calcon indicator , copper sulphate , ebt indicator , ferrous ammonium sulphate , gum accasia , l ascorbic acid , murexide , orthophosphoric acid , potassium permanganate , potassium sulphate , selenium metal powder , sodium hexa meta phosphate , sodium hydroxide pellets , sodium acetate , ammonium hydrogen carbonate , maleic acid , citric acid , oxalic acid , potassium dihydrogen orthophosphate anhydrous , methyl orange indicator , methyl red indicator , malic acid , gum acacia powder , guar gum powder , potassium dicromate , potassium cloride , ammonium metavandate , concentrated sulfuric acid , orthoposphoric acid , ferrous ammonium sulphote , potossium permangnate , sodium hydroxide , methyl red , bromocresol green , azomethine , standard hydrochloric acid , sodium bicorbonate , dargo g 60 activate charcol , ammonium paramolybdate , antimony potassium tartrate , ascorbic acid , potassium dihydrogen orthophocphate , calcium cloride , magnesium cloride , potassium nitrate , gum acacia , dtpa diethylenetriamine penta acitic acid , tea triethonol amine , buffer tablet ph 4.0 7.0 9.2 , microplate , ethanol

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government/Public Sector

CTN :39838138

08 Apr, 2025 NA

Solapur - Maharashtra

Tender For supply of 11727 - eye drop. boric acid 1.25% + cpm 0.01% + zinc sulph 0.12% + naphazoli ne hcl 0.056% + sod. chl. 0.05% eye drops ]

CTN :39320533

28 Mar, 2025 20.23 Lacs

Ranchi - Jharkhand

Tender For bid to ras supply of ether solvent , ketamine hcl 50 mg oblique ml 2 ml inj , thiopentone inj of 0point5 g without water for injection , bupivacaine hcl 5 mgobliqueml 20 ml inj , bupivacaine hcl 5 mgobliqueml heavy 4 ml inj , lignocaine hcl 2percent without adrenaline 30 ml inj suitable for ophthalmic use also , lignocaine hcl 2percen with adrenaline , lidocaine oblique lignocaine hcl 2percent with adrenaline , atropine sulphate 0point6 mg 1 ml inj , peracetic acid bott of 810 gm , diclofenac sodium suppository 100 mg , indicator soda lime , paracetamol with cysteine hcl monohydrate infusion 1000mgoblique100ml , common cold tab antihistiminics plus paracetamol 500 mg without pseudoephedrine , etoricoxib 120 mg tab , piroxicam 20 mg tab , fentanyl citrate 50mcgoblique ml 2 ml inj , fentanyl 50mcgoblique ml 10 ml inj , morphine 15 mg 1 ml inj , indomethacin 75 mg sr tab , indomethacin 25mg tab oblique cap , ketorolac 10 mg tab , tramadol hcl 50 mg cap oblique tab , betamethasone 4mg 1ml inj , adrenaline tartrate 1 isto 1000 coma 1 ml inj , levo des cetrizine 5mg tab , dexamethasone 0point5 mg tab , pheniramine maleate inj 22point75 mg per ml amp of 2 ml , methylprednisolone 16 mg tab , promethazine hcl 2point5 percent 25mgm oblique ml 2 ml inj , levetiracetam 100mg oblique ml vial of 5 ml inj , piracetam 400 mg tab , oxcarbazepine 150 mg tab , carbamazepine 200 mg tab , clonazepam 2 mg tab , lorazepam 2mg oblique ml 2 ml inj , diazepam 5 mg tab , lamotrigine 25 mg tab , lamotrigine 50 mg tab , sumatriptan 50 mg tab , topiramate 25 mg tab , rizatriptan 5 mg tab , baclofen 10 mg tab , acebrophylline 100 mg cap , budesunide 1 mg respules , carbimazole 20 mg tab , ethambutol 1200 mg tab , mycophenolate mofetil 250 mg tab , diethylcarbamazine 50mg tab , clofazimine 100mg cap , rifampicin 150mg cap , rifampicin 600 mg plus tab inh 300mg tab , ethambutol 200mg tab , isoniazid 300 mg tab , chloroquine phosphate 250mg tab , primaquine 7point 5mg base tab , silver sulphadiazine 1 percent ointment 20 gm tube , azathioprine 50mg tab , cyclosporine a micro emulsion 25 mg cap , hydroxyurea 500 mg cap , methotrexate 5 mg tab , inj goserelin 3point6 mg prefilled syringe zoladex 3point6 mg , letrozole 2point5 mg tab , levodopa 100 mg and carbidopa 25 mg tab , amantadine 100 mg cap , cabergoline 0point5 mg tab , rasagiline 1mg tab , trihexyphenidyl hcl 2 mg tab , tab levodopa 125 mg , tab levodopa cr 250 mg , tab topiramate 50mg , tab pregablin 75 mg , ferric hydroxide sucrose complex 20 mg in 5ml for injection , erythropoeitin human recombinant 2000 iu , tranexamic acid 500 mg oblique 5ml inj , phytomenadione vit k 1 mg oblique 0point5 ml inj , prasugrel 10 mg tab , fenofibrate 160 mg tab , carvedilol 3point125mg tab , diltiazem 60 mg tab , diltiazem controlled delivery 90mg tab , fenofibrate 200 mg tab , isosorbide dinitrate 10 mg tab , isosorbide mononitrate 20 mg tab , tab perindopril 8mg , esmolol 100 mg 10 ml inj , prasugrel hcl 5 mg tab , lignocaine hcl solution 2percent for iv use 50 ml inj , enalapril maleate 10 mg tab , enalapril maleate 2point5 mg tab , nebivoilol 5mg tab , labetalol hcl 100 mg tab , metoprolol 1 mg oblique ml 5 ml inj , nifedipine retard 20 mg cap oblique tab , propranolol tr 40 mg tab , ramipiril 2point5 mg tab , digoxin 0point25 mg tab

Central Government And Public Sector

CTN :39809411

21 Apr, 2025 NA

Angul - Odisha

Tender For supply of boric acid

Central Government/Public Sector

CTN :39772518

12 Apr, 2025 NA

Koraput - Odisha

Tender For supply of boric acid

CTN :39796668

25 Mar, 2025 NA

Nadia - West Bengal

Tender For supply of sulfuric acid 98% (2.5 l) , sodium hydroxide (500 g) , acet ic acid glacial 100 % (500 ml) , ascorbic acid (100 g) , hydroge n peroxide (500 ml) , potassium dichromate (500 g) , diphenylamine for synthesis (100 g) , ortho-phosphoric acid 88% (500 ml) , ammonium iron (ii) sulfate hexahydrate (500 g) , charcoal act ivated (500 g) , boric acid powder (500 g) , pot assium permanganate (500 g) , perchloric acid about 70% (500 ml) , diethylenetriaminepentacet icacid (dtpa) (250 g) , ammonium acetate (500 g) , nitric acid about 69% (500 ml) , hydrochloric acid about 37% (500 m l) , ammonium fluoride purified (500 g) , triethanolamine (500 ml) , calcium chloride dihydrate (500 g) , potassium antimony (ii i) oxide tart rate hemihydrate (250 g) , methyl red indicator (25 g) , 2-4 dinitrophenol hyd razine 97 % , ammonium chloride (500 g) , salicylic acid (500 g) , disodium-edta (500 g) , azomethine-h (1 g) , kh,po. (potassium dihydrogen phosphate) (500 g) , nh. -oxalate (ammonium oxalate) (500 g) , nh.oh (ammonium hydroxide) (500 ml) , oxalic acid (500 g) , concentrated hf (hydrofluoric acid) (500 ml) , azocarmine (25 g) , ethyl alcohol (500 ml) , magnesium oxide (500 g) , k,so. (potassium sulphate) (500 g) , cuso. (copper sulphate) (500 g) , ammonium metavanadate (100 g) , 2,6-dichloro phenol indophenol (5 g) , sodium hydroxide (500 g) , ferrous ammonium sulphate (500 g) , sodium acetate (250 g) , tris acetate buffer (100 g) , potassium iodide (250 gm)

CTN :39668047

03 Apr, 2025 NA

Bhopal - Madhya Pradesh

Tender For tender for purchasing of chemicals in controller food and drug - list of chemicals, acetonitrile, acetic acid, ammonium formate, methanol, formic acid, nitric acid, hydrogen peroxide, magnesium sulphate (anhydrous), hydrochloric acid, c18 cleaning salt, ascorbic acid, primary secondary amine, sodium accetate anhydrous, ammonium formate, ammonium hydrate, tetra butyl ammonium hydride, tetrabutyl ammonium sulphate, methyl chloride, dansyl chrodide solution, green s, ethanol, ammonium phosphate monobasic, acetic acid glacial, methylene chloride, ethyl ether, n-hexane, toluene, ethyl acetate, potassium phosphate monobasic, ortho phosphoric acid, ammonium acetate, sodium sulphate anhydrous, alchohol ethanol, acetic acid glacial, acetone (hplc), aluminium oxide (activated), amonium solution, potassium sulphate, potassium iodide, silver nitrate, alkali blue 6b, boric acid, sodium thiosulphate, eosin 2% (staining solution), calsium chloride, carbon tetrachloride, barium chloride(dihydrate), edta, erichrome black-t, furfural, orthophosphoric acid, glycerol, hydrochloric acid, isopropanol, iso-amyl alchohol, methanol(hplc), nitric acid, petroleum ether 40-60, petroleum ether 60-80, phenolphthalein, potassium permagnate, resourcenol, sucrose, sulphuric acid, tlc plate, hplc water, dyethyle ether, chloroform, amylacitate, fehling sol. a, fehling sol. b, iodine resublimed, sodium hydroxide pellets, cyclohexane, methanol, ammonium chloride, ammonium hydroxide, murxide, pattons and readers, calcium, trifluoro acetic acid, edta disodium salt(dihydrate), name of culture media/serum/ chemical, agar base, baird parker agar base, egg yolk tel emulsion(50ml/100ml per vial), bismuth sulphite agar, bhi broth, brilliiant green bile broth 2%, buffered peptone water, cooked meat medium (rc medium), carbohydrate consumption broth, decarboxylase test medium (falkow), dextrose tryptone agar, fraser broth base, fraser selective supplement, fraser supplement, emb agar, levine, hugh-leifson medium, kligler iron agar, koser citrate medium, lactobacillus mrs agar, lactose broth, lysine iron agar, macconkey agar, motility test medium, mr-vp medium, myp agar base (phenol red egg yolk polymyxin agar base), poly b selective supplement, egg yolk emulsion(50ml/100ml per vial), modified listeria oxford agar base, colcef selective supplement, nitrate broth, nutrient broth, peptone water diluent, plate count agar, listeria identification agar base (palcam), palcam selective supplement, selenite cysteine broth, sheep blood agar base, thiosulphate citrate bile salt sucrose agar(tcbs), triple sugar iron agar, tryptone broth (tryptone water), urea agar base, xylose lysine deoxycholate agar (xld agar), tryptic soy agar, violet red bile agar, perfringens agar base, tsc selective supplement, cmf selective supplement, tryptone glucose extract, thioglycolate agar, tryptone salt agar w/1% nacl, tetrathionate broth base (w/o iodine & bg), potato dextrose agar, phenol red broth base, my 40 (osmophillic agar), acetate agar, czapek yeast (autolysate) agar, 10% lactic acid solution (10 ml/vial), ec broth, gn broth, hajna, hektoen enteric agar, lauryl sulphate broth (lauryl tryptose broth), liver broth / l-broth, modified, malonate broth, malt agar, mannitol salt agar base, glucose agar, yeast extract powder, peptone, rappaport vassilidis medium, saline nutrient agar, alkaline saline peptone water, onpg broth, bolton broth base, bolton selective supplement, violet red bile glucose agar w/o lactose, iron sulphite agar, ellners broth, willis and hobb s medium, glucose of medium, tryptone bile glucuronic agar (tbx agar), tergitol-7-agar base, ttc solution 1% (10ml/vial), macconkey broth, macconkey broth purple, simmons citrate agar, macconkey sorbitol agar, tryptone soya yeast extract broth, hicrome listeria ottaviani agosti agar, oa selective supplement, lp enrichment supplement, mueller kauffman tetrathionate broth base, chromogenic coliform agar, slantz & burtley medium, bile

Private Sector

CTN :39725493

27 Mar, 2025 NA

Jhajjar - Haryana

Tender For fine chemicals - petroleum ether 60-80 deg. c, chemicals chlorotex reagent, sulphuric acid :(ar/gr/excelr), hydrochloric acid conc. ar/gr, acids:-nitric acid ar, acetone, ammonium molybdate ar/gr/excellar, ansa, ar/gr/excellar,100 gm, chemical: buffer solution of ph-4.00, chemical: buffer solution of ph-7.0, chemical: buffer solution of ph-10.0, potassium hydroxide pellets ar, boric acid ar/gr/excelar, ammonium metavandate ar/gr/excelr, sodium nitrate; ar/gr/excelar grade, sod. meta silicate lab(ar)

State Government

CTN :39651897

01 Apr, 2025 8.00 Lacs

Delhi - Delhi

Tender For supply of chemical - butan 2 one butanone ethyl methyl ketone 500ml , 1 bromobutane 500g , 4 bromobenzaldehyde 250g , acetic acid glacial 25ltr , acetone 25ltr , acetone uv hplc 500ml , acetonitrile 500ml , acetophenone 500ml , acetyl acetone 500ml , acetyl chloride 500ml , alpha naphthol 1 naphthol 100g , ammo ferrous sulphate ar , aluminium ammonium sulphate 500 g , aluminium chloride 500g , ammonia liquor 500ml , ammonium acetate 500g , ammonium chloride 500g , ammonium nitrate 500g , ammonium thiocyanate 500g , aspirin 250g , s benzyle thiuanium chloride 500g , benzaldehyde 500ml , benzamide 500g , benzil 250g , benzoic acid 500g , benzoyl chloride 500ml , benzyl tri phenyl phosphonium chloride 500g , bismuth nitrate 100g , boric acid 500g , bromine 20x5ml , bromobenzene 250ml , butyl alcohol 25ltr , carbon tetra chloride 500ml , cetyl alcohol 500g , chlorobenzene mono chlorobenzene 500ml , chloroform 500ml , cobalt chloride 100g , cobalt chloride hexahydrate 100g , copper acetate monohydrate 250g , copper sulphate cuso45h2o ar , cyclohexanone 500ml , d fructose 100g , di ammonium hydrogenphosphate , di butyl phthalate 500g , di sodium tetraborate borax 500g , dl tryptopan 10g , ethyl aceto acetate 500ml , glycerine glycerol , hexane 500ml , hydrochloric acid gr 500ml , hcl , iodine 100g , iron sulphide 1kg , lead carbonate 500g , magnesium stearate 500g , magnesium trisilicate 500g , maleic anydride 500g , manganese ii sulphate 500g , methanol 500ml , methyl acetate 500ml , mineral oil , n butanol 25ltr , n butyl acetate 500ml , nitric acid ar 500ml , nitric acid lr 35kg chaudhey chemicals , n methyl aniline 500ml , orthophosphoric acid 25ltr , oxalic acid ar 500g , parabens 500g , phenyl hydrazine hydrochloride 100g , phthalic acid 500g , pigment 500g , polyphosphoric acid 500g , potassium bromate 500g , potassium dichromate 500g ar , potassium iodide , potassium oxalate 500g , potassium phosphate tribasic 500g , potassium sodium tartrate 500g , rhodamine d 100g , semicarbozide hydrochloride 100g , sodium acetate anhydrate 500g , sodium acetate anhydrous 500g , sodium bicarbonate 500g ar , sodium hydroxide pelletes 500g , sodium oxalate 500g ar , sodium sulphite 500g , stearic acid coloring agent 500g , succinic acid 500g , sucrose 500g , sulphuric acid lr 4 5kg chaudhry chemicals , t butanol 500ml , t butyl cyclohexanone 500ml , tlc silica gel aluminium plates , toluene 2 5ltr , tri sodium citrate 500g , tryptophan 25g , urea 500g , beaker 100ml , beakers 250 ml , beakers 400 ml , bodmel flask melting point appertus , boiling tube , brush semi miceo kit , brush bottle 18 , burette clamp boss head , burette clamp fish type , capiller tube pkt , conical flask 150 ml , conical flask 250 ml , dropper 6 glass , dropper 3ml plastic 500pcs , dropper 1ml plastic 500pcs , filter paper whatman no curculer , filter paper crometography , filter paper ordnery extra obgerb500 sheet rim , funnel 2 , labolin 5ltr , measuring cylender 10 ml borosil glass , measuring cylender 25 ml borisil glass , rubber tube 5mm , rubber tube 6mm , rubber tube 7mm , rubber tube 8mm , rubber tube 9 mm , spatula steel 6 , test tubes 15 125 mm 100pcs , viscometer borosil glass , volumetric flask 100 ml , water bath alluminium , wire gauze bid details/ 2 / 103

Boric Acid Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government And Public Sector

Central Government/Public Sector

Private Sector

State Government