Latest diluting fluid Tenders | Government diluting fluid Tenders

State Government

CTN :39826251

10 Apr, 2025 50.00 Lacs

Kotdwar - Uttarakhand

Tender For lab reagents supply work at govt base hospital kotdwara - items articals for lab, binocular microscope with lens, electrolyte (na+,k+,ca+) pack, esr disposable westergren tube, esr stand wintrobe, esr stand westergren, spirit lamp, test tube rack (aluminium), slide box, hot air oven, incubator, stethoscope, blood pressure machine, physical balance &weight box, rh viewing box(electrical), photocaloriemeter, oil immersion lens 100x, stopwatch, timer, vdrl shaker with timer, semi auto analyser, antisera abd, acetone, acetic acid glacial, ammonia solution, ammonium sulphate powder, ammonium oxalate powder, auto pipette 5-50ul, benedicts solutionqualitative, benedicts solution quantitative, brush test tube, barium chloride 10%, conc . hcl, conc. h2so4, conc hno3, carbol fuchsin, test tube rack aluminium, high power lens 40x, low power lens, auto pipette 50-200ul, auto pipette 1000ul`, auto pipette 500ul, auto pipette 10ul, dropping bottle plastic 1000ml, neubaver counting chamber, disodium hydrogen phosphate, dropping bottle plastic125 ml, distilled water, eosin powder, edta powder, ethenol, eherlichs reagent, aec diluting fluid, edta vial, esr filling needle, fouchets reagent, filter paper, beaker plastic 100-1000ml, beaker glass 100-1000ml, centriguge tubes, glass test tube 12*75, glass test tube 12*100, glass cover slip, glass slide, glass capillary tube, glass haemoglobinometer, hb measuring tube 2-20%, glass pipette for hb 20ul, glass rbc pipette, glass wbc pipette, glass funnel, glass marking funnel, grams iodine, hydrogen peroxide, washing solution, pm kit (semi auto), am kit ( semi auto), glass cover slip, vacutainer vial red top, vacutainer vial, vaccutainer needles, aliquet 2ml, fluoride vials, sodium citrate vials, glass wbc pipette, glass funnel, dengue ns1ag/igm/igg card test, leishman stain, liquid paraffin, litmus paper red, litmus paper blue, methylene blue, multisticks for urine exam, malaria antigen card test, mountex ppd vial, n/10 hcl, pregnancy card test, typhoid dotigm/igg, vdrl card test, hbsag card test, hcv tridot, hiv tridot, urinometer glass, wintrobe esr tube, westergren esr tube, platelet diluting fluid, potassium oxalate, potassium dichromate, plastic washing bottle 250 ml, plastic stand, plastic funnel, pasteur pipette, potassium permagnate, printer roll/ paper, plane vial, edta vial, rubber bulb, rbc fluid, wbc fluid, sodium sulphate powder, sulphur powder, tips auto pipette white, tips auto pipette yellow, tips auto pipette yellow, semen diluting fluid, sodium hypochloride solution, tourniquette strong, tissue paper, uristicks for albumin sugar, urine collection pot disposable, wintrobe tube filler, xylene, liquor ammonia, acetone, aso latex slide test, raf latex slide test, crp latex slide test, rapid pap stain, diamond glass marker, gram stain, fnac plunger, ethanol, coverslip for fnac, mgg stain, gills haematoxylin stain, og / ea stain, 1% glacial acetic acid, wbc count fluid/ turk fluid, giemsa stain, spirit lamp, occult blood card test, water bath, thermameter

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government/Public Sector

CTN :39837733

10 Apr, 2025 NA

Itarsi - Madhya Pradesh

Tender For supply of boron free non chromate type corrosion

Central Government/Public Sector

CTN :39774589

12 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals and consumables - oxalic acid graterthan 99point5 percent cas 6153-56-6 , 2 4 dinitrophenol 99 percent cas 51-28-5 3x100gm , abts 2 2-azino-bis 3-ethylbenzothiazoline-6-sulfonic acid diammonium salt 30931-67-0 , acetylcholine chloride ar 1 pack of 10 g , ag agcl 3m kcl reference electrode basmf2056-1ea , ag 50w to x8 cat exch resin biotechnology grade 100 to200 mesh hydrogen form , al2o3 pl slurry 0.05meu 1pkt of 10g , al2o3 pl slurry 0.3meu 1pkt of 10g , al2o3 pl slurry 0.5meu 1pkt of 10g , aluminium foil 25micrometer 20 roll per piece 50m , ammonium fluoride ar acs assay 98 percent cas 12125- 01-8 1pack of 25 g , arsenic iii oxide ar assay 99 percent cas 1327-53-3 1pack of 500g , benzofuran for synthesis cas no 271896 b8002-25g , bis salicylaldehyde orthophenylene diamine reagent , bolds basal medium , boron trichloride 178934-100g , bromcresol green cas 76- 60-8 , bromcresol purple ar cas 115-40-2 , bromphenol blue ar cas 115-39-9 , cadmium nitrate tetrahydrate purified assay 99 percent cas 10022-68-1 1pack of 100 , cellulose acetate cas 9004-34-6 , cellulose powder, for column chromatography , centrifuge tube box polypropylene 15ml tarson polylab axiva , centrifuge tubes 50 ml 5 packets 200pc per pack , cetrimide agar , chitosan cas 9012-76-4 , cholchicine 64-86-8 , copper sulphate anhydrous cas no 12852-250g , cresol red ar, cas 1733- 12-6 , cuprous iodide 99 percent cas 7681-65-4 , curcumin grater than equal to 94 percent purity cas no 458-37-7 00280590-10 mg x2 00280590-10mg , curcuminoids 80 percent purity cas no 458-37-7 c7727-500mg , desicator vaccum polypropylene diameter 200mm tarson or polylab , dichloromethane 34856-1ltr , dimethylamine cas 124-40-3 , dmf cas no 68122 , dmso cas no 67-68-5 , dpph cas no 1898664 d9132-5gm , dulbecco phosphate buffered saline d5652-10x1l , eppenndorf-microcentrifuge tubes 1.5ltr , ethanol 99 percent , ethylenediaminetetraacetic acid disodium salt dihydrate , centrifuge tubes 15ml , folin and ciocalteu phenol reagent , formaldehyde cas no 50-00-0 252549-100ml , formic acid gr 98.0-100 percent cas no 64- 18-6 , furan for synthesis assay 99 percent cas 110-00-9 1 pack of 100ml , furfuraldehyde ar acs assay 99percent cas 98-01-1 1 pack of 500 , gallic acid 149-91-7 , glycerol 56-81-5 , graphite fine powder 98percent cas 16940-66-2 , high salt medium , hydrogen peroxide solution 30percent cas 7722-84-1 , icp multi-element standard solution iv sigma merck 23 elements in diluted nitric acid 1000 mg l ag, al, b, ba, bi, ca, cd, co, cr, cu, fe, ga, in, k, li, mg, mn, na, ni, pb, sr, tl, zn , immersion oil , in line syringe filter holder 25mm psf tarson or polylab or axiva , in line syringe filter holder 47mm psf tarson or polylab or axiva , iron oxide cas no 1309-37-1 , l-malic acid 99percent cas 97- 67-6 , lb broth , macconkey agar , mask , methyl diethanol amine cas 105-59-9 , methyl orange cas 547-58-0 3x100gm , methyl red cas 493-52-7 3x100gm , methyl yellow cas 60-11-7 3x100gm , mini spatula , n-methyl-2- pyrrolidone for hplc 99percent , naoh-solid cas no 1310732 6x1kg , neutral red ar cas 553-24-2 , nutrient agar , nutrient broth , p-nitrophenol ar cas 100-02-7 , parafromaldehyde cas 30525-89-4 , petroleum ether cas no 8032324 , phenol red sodium salt indicator cas 34487- 61-1 , phenolphthalein indicator cas 77-09-8 5 x100gm , phenyl boronic acid cas 98-80-6 1pack of 25g , pipette rack horizontal z shape polypropylene tarson or polylab oraxiva , pnpa-paranitrophenylacetate 2 bottle of 25g , polyvinylidene fluoride cas 24937-79-9 , polypropylene beaker garduated 500mltarson or polylab or axiva , polypropylene forcep , polypropylene measuring cylinder graduated class a 500ml tarson or polylab , potassium hydroxide 90 percent flakes 484016-1kg , potassium permanganate 238511-100gm , potassium persulphate 7727-21-1 , potassium sulphate cas no 7778805 223492- 500gm , potato dextrose agar , potato dextrose broth , ptfe stirrer 10 x 250mm , pyrrole for synthesis assay 97.

CTN :39786118

26 Mar, 2025 95.00 Lacs

Phalodi - Rajasthan

Tender For corrigendum : e tender for lab items - drabkin solution for hb estimation, tlc dilueting fluid, tlc pipette, dlc diluting fluid, dlc pipette, platelate count fluid, esr pipette disposable, anti a sera, anti b sera, anti d sera ( igg & igm), anti human globulin ( coombs reagent), normal saline, test tube glass 12 x75, test tube glass 12x100, droper plastic, slide pkt iso mark, cover slips 18x18, giemsa stain, leishman stain, paraffin oil, slide tray aluminum, distilled water, methanol, reticulocyte count fluid, methylene blue soln, brilliant cresyl blue soln, eosinophill count fluid, hemocytometer ( counting chamber ), bt ct capillary, filter paper, stop watch/timer, alcohol swabs, sickling test for sickle cell anemia, sickling rapid test for sickle cell anemia, nestroft test for screening of thalessemia, dcip for screening for hbe hemoglobinopathy, quantitative test g6pd deficiency, malaria rapid card test, pt reagent, sodium citrate tube for pt test, aptt reagent, calcium chloride soln, hcg ( pregnancy card), urine strips for ph,sg,tlc,glu,bil,uro,ketone,protein,nitrate, urine container plastic 30ml, test tube disposable plastic 12x100 ( 4 " ), urine strips for microalbumin, urine strips for acr, test kit for stool for ova and cyst, test kit for occult blood, semen diluting fluid, dengue rapid card test (igg,igm & ns1 ag combo), typhoid card test antibody, rpr /vdrl test for syphilis ( rapid card tests), rapid test card for the simultaneous detection of malara pv/pf antigen, s.thphi ( igm antibodies) and dengue ns1 antigen from a single card ( combo), hiv rapid card test with single step procedure ( serum and plasma), hbsag rapid card test 0.1 iu/ml senstivity, anti hcv rapid card test, rapid test card for the simultaneous detection of hiv 1& 2,hcv,hbsag ,syphilis from a single card ( combo), afb stain kit, widal test kit, blood sugar kit, gtt test kit, bilirubin total & direct kit, creatinine kit, urea test kit, uric acid test kit, sgpt test kit, sgot test kit, alkanine phosphate test kit, total protein test kit, albumin test kit, globulin test kit, total cholesterol test kit, triglycerides test kit, vldl direct test kit, hdl direct test kit, ggt test kit, amylase test kit, iron test kit, tibc test kit, hba1c test kit, s.calcium kit, s.magnesium test kit, acid phosphatest test kit, grams stain soln, thorat swap for diphitheria, visual inspection acetic acid, rk 39 for kala azar by rapid card test, smear for filaria, montex test 5tu, montex test 10tu, tuberculin syring for montex test, troponin i rapid card test, trop t rapid card test, ra quantitative test kit, crp quantitative test kit, aso quantitative test kit, blue tips, clot activator non vaccum tube double cap, edta nonvaccum tube double cap, jsb stain 1, jsb stain 2, keto stix, lugol iodine, methanol 5ltr, microscope bulb, printer paper roll 57mmx10mtr, printer paper roll 57mmx20mtr, sodium citrate soln, sodium hypochlorite soln, tissue paper roll, urine strips 04 parameter, yellow tips, electrolyte analyzer as per enclsoed technical specifications, 5 part hematology analyzer as per enclosed technical specifications, fully automated immunoassay analyzer ( clia) as per enclosed technical specifications, semi automated bioschemistry analyzer as per enclosed technical specifications

CTN :39799307

31 Mar, 2025 5.00 Lacs

Sikar - Rajasthan

Tender For rate contract for consumables and reagents (anatomy & physiology dept.)-, formalin (of standard quality for dissection hall uses), , glycerin, , thymol crystal, , h2o2, , phenol, , eosin, , gough roll (12"), , cotton roll, , bed sheet, , surgical mask, , gardner shoes (8 no.), , gardner gloves (normal size), , disposable gloves (7 no.), , disposable gloves free size, , reagents/consumption, , leishmans stain, , glacial acitic acid, , n/10 hcl, , cover slip (18mm), , hayems fluid(rbc diluting fluid), , turks fluid(wbc diluting fluid), , platelet fluid, , 8, , esoinophil diluting fluid, , 9, , filter paper, , 10, , antisera a, b & d, , 11, , capillary glass tube, , 12, , tooth pick, , 13, , lancet, , 14, , laboratory steel stand for slide wash, , 15, , spirit, , 16, , sodium hypochloride, , 17, , lens cleaning solution and cloth, , 18, , glass marking pencil, , 19, , rbc pipettes, , wbc pipettes, , hemoglobin pipette, , homocytometer, , ecg paper strip roll, , ecg cardio gel, , container for sharp waste (small), , gloves, , surgical mask, , bio medical waste polybag all color big size, , , ,

CTN :39799312

31 Mar, 2025 8.00 Lacs

Sikar - Rajasthan

Tender For rate contract for consumables and reagents (pathology dept.)-, glass slides, , fixative (95% ethyl alcohol), , n/10 hcl, , gloves (6.5" and 7") (nitrile gloves), , turk's fluid/wbc diluting fluid, , leishman stain, , anti sera, , field stain (a & b), , spirit (methanol), , dropper 3 ml, , dropper 5 ml, , cover slip (22mmx22mm), , cover slip (22mmx55mm), , benedict reagent, , sulphur powder, , glass test tube (10ml), , rack for (10ml) test tubes holding, , 5, , test tube holder for 10 ml test tube, , immersion oil (liquid paraffin oil), , spirit lamp, , 1, , needle-23 guaze, , 2, , needle-22 guaze, , 3, , syringe (5 ml), , 4, , syringe (10 ml), , 5, , sodium nitropruside, , 5, , liquid ammonia, , 7, , ammonium sulphate, , 3, , protein powder (proteinex), , afb stain kit, , urine strip, , 1, , spirit swab, , 2, , diamond pencil, , b, , h & e kit, , 4, , giemsa stain kit, , 5, , pap stain kit, , 5, , cotton roll, , 7, , urine container, , 3, , xylene, , torniquate belt, , glass beaker 1000ml, , glass beaker 2000ml, , blade microtome low profile, , dpx mountant, , formalin, , glycerol, , isopropyl alcohol, , paraffin wax with ceresin 60 degree,

CTN :39809779

14 Apr, 2025 18.95 Lacs

Amritsar - Punjab

Tender For supply of hiv elisa kit of 50 test - hiv elisa kit of 50 test , hbaag elisa kit of 50 test , hcv elisa kit of 50 test , vdrl test kit of 50 test , hiv 1 and 2 rapid test 4 generation kit of 50 test , hbsag rapid test kit of 50 test , hcv rapid test kit of 50 test , hemocue microcuvetters for hb percentage estimation , temp chart recorder for blood bank refrigerator 2c to 10c helmer , temp chart recorder for blood bank refrigerator 2c to 10c remi , esr test tube westergren method , tlc diluting fluid 100ml , rbc diluting fluid 100ml , giema stain readymade , reticulocyte stain 500 ml ready made cytochrome , leishman stain 500ml ready made cytochrome , phosphate buffer ph7.0 , glass tube 10 ml , rapid aso titre kit 20 test , rapid widal test kit 4 x 5 ml , grcott stain bott of 100 ml , pas stain bott of 100 ml , chlorofoam ar bott of 500 ml , acetone bott of 500 ml , emirsion oil for microscope bott of 30 ml , liquor ammonia bott of 500 ml , vaccutainer edta for paedriatric , vaccutainer sterile for paedriatric , glucose powder , blood cultur bottle adult , blood cultur bottle paediatric , swab stick sterile , syringe 2 ml , syringe 5 ml , syringe 10 ml , syringe 50 ml , vaccutainer sterile tube with needle gel 5 ml , vaccutainer sterile tube with needle without gel 5 ml , vaccutainer edta 3ml with needle , vaccutainer sodium flouride 5 ml with needle , vaccutainer sodium citrate 3 ml with needle , tourniquete , micropipettes tips for 1-200 iu pkt of 1000 , tissue embedding ring plastic white, 1 cm height form base , tissue embedding ring plastic orange 1 cm height form base , tissue embedding ring plastic yellow 1 cm height form base , tissue embedding cassette metal 3 x 3 point 5 x 1 cm , tissue embedding ring plastic green 1 cm height form base , new methylene blue rtu bottle of 120 ml , wright stain rtu bottle of 500 ml , viral transport media with two swabs , c reactive protein kit for 50 test , pt reagent kit of 25 tests , tissue cassettes and block holders , stainless steel tissue embedding moulds size small pack of 50 and large pack of 50 , uti cytochrome agar pack of 500 gm , hemocue rapid staining of blood smear sigma aldrich

Central Government/Public Sector

CTN :39738182

02 Apr, 2025 40.00 Lacs

Dhubri - Assam

Tender For supply of chemicals & reagents for ccl and ug laboratories of dhubri medical college & hospital on rate contract basis - mg stain, methanol, giemsa s stain, tissue roll, zn stain, glass slide, diamond pencil, slide tray, syringe 2 ml, syringe 5 ml, syringe 10 ml, syringe 20 ml, gloves 6.5, gloves 7, gloves 7.5, spirit bottle, slide storage box, paper plaster (slide paper plaster), n 95 mask, spirit lamp, stop watch, big tray, bikar 100 ml, face mask, glass slide box, coplin jar, spray sanitizer 500ml, dropper 2ml, dropper 3 ml, dropper 5ml, dpx mount, slide stand ss rod, cell pack (cell counter machine), lyser cell wdf (cell counter machine), flurocell wdf (cell counter machine), sulfolyser wdf(cell counter machine), cell clean sysmex (cell counter machine), sysmex qc- l1,l2,l3(cell counter machine), deka phan auto (laura xl urine analyser), optisol -1500(laura xl urine analyser), optisol-750(laura xl urine analyser), urinorm xl-qc(laura xl urine analyser), urinorm xl-qc(laura xl urine analyser), test tube for laura xl 12mm x 100mm urine analyser, benedicts, urine strips 10 parameters, urine pot, esr controls (30 touch cube), esr controls (30 touch cube), esr disposable pipettes, esr stand, esr transponder (30 touch cube, protime ls (automated coagulation machine), erba clean 1(automated coagulation machine), erba actime, calcium chloride (automated coagulation machine), single reaction cuvettes, erba control p (automated coagulation machine), erba control n (automated coagulation machine), distilled water, hyphochloride, semen diluting fluid, microscop slide box, edta vials, pt-inr vials, abo grouping set, blood lancet (accusure safety lancet), leishman stain ( qualigens), giemsa stain (merck), slide rack, cover slip, cover slip, methanol, xylene, human d brilliant crystal, immerson oil ( cedar wood oil), filter paper, improve neuber chamber, wbc diluting fluide, esr westergren tube, ria vials, test tube holder, pipettes, pipettes, pipettes, micro tips (100-1000 ul), micro tips (2-200 ul), micro tips (0-10 ul), hb typing / hb electrophorosis hplc ( d-10 reagents), esr and cougalation thermal paper, blood shaker toler, cell counter dlc, glass beaker, glacial acetic acid, cover slip ( blue star 22x50=25 (10 gm) central drug ware house guwahati,narengi, cover slip 18mm x 18mm (10gm), 1.5 ml sample cup (automated coagulation machine), ammonia solution, ammomium sulphat salt, sodium nitroprosside, carbon brash for h/b tube, touroniquet belt, hemoglobinometer haemometer, wbc pipette, rbc pipette, wintrobes tub, westergreen pipette, lp needle, bone marrow aspiration needle, bone marrow aspiration needle, bone marrow aspiration needle, bone marrow biopsy needle, bone marrow biopsy needle, bone marrow biopsy needle, urinometer, surgical tray with lid, litmus paper red, litmus paper blue, fixed micro pipette, fixed micro pipette, test tube, reagent bottle, at home grossing bench, grossing board, tissue provessing container, microtome blade, microtome blade, formaldehyde, distilled water, xylene (clearing), parafin wax 60 degree celcius, acetone, glycerine, tissue cassette, container (tissue collecting), copling jar (plastic), h & e stain, absolute alcohol, leveling paper, hcl (decalcification), microtome knife, surgical blade, surgical blade, measuring cylender, measuring cylender, measuring cylender, slide storage box, ada, diabetes control (bilevel), assayed chemistry control -i, assayed chemistry control -ii, immuno assay plus control -i, immuno assay plus control -ii, cardiac marker plus control - i, cardiac marker plus control - ii, eqas(external quality assurance services), desktop label printer, label 50*25*1dt per 1000, ribbon 80*75*w333, syringe & needle destroyer, room temp. meas.thermometer, digital thermometer for deep freezer, fixed micropipette, fixed micropipette, fixed micropipette, fixed micropipette, variable micropipette, variable micropipette, micro centrifuge tube, micro centrifuge tube, multi layer

CTN :39739215

08 Apr, 2025 20.00 Lacs

Kangra - Himachal Pradesh

Tender For nit for the purchase of lab reagents - (n/10) hydrochloride solution (haemoglobin estimation) 500ml, (n/10) hydrochloride solution (haemoglobin estimation) 100ml, haematology test reagent for automated haematology analyzer (3 part) sysmex-kx 21, stromatolyser (3 x 500)ml, stromatolyser (3 x 500)ml, tri level controls (each), cell pack 20 ltr, paper roll (53mm) each roll, pm kit kx 21, calibrator for kx-21, haematology test under microscope, wbc diluting fluid (tlc) 100 ml, total eosinophil count fluid 100 ml, rbc diluting fluid (total blood cell count) 100ml, platelet diluting fluid (platelet count) 100ml, distil water 5 ltr, blood grouping (abo-rh typing)anti abd ( 3 x 10 ml), blood grouping (abo-rh typing)anti- h 10 ml, anti-a1 5 ml, bovine albumin 10 ml, ahg 5ml, jsb stain-i, jsb stain-ii (malaria parasite) 500 ml, jsb stain-i, jsb stain-ii (malaria parasite) 125 ml, copper sulfate 500 gm pack, 3.8% sodium citrate solution (esr) 500 ml, coombs reagent (direct & indirect) (ahg anti c3d monoclonal) 10 ml, coombs reagent (direct & indirect) (ahg anti c3d monoclonal) 5 ml, laboratory stain (giema stain, leishman stain), giema stain 500 ml, leishman stain 500 ml, immersion oil (microscope) 30 ml, occult blood test, rpr card (syphilis)each, hiv rapid (each), hiv elisa method (each), rheumatoid factor (rh typing) 1 x 100 test, aso (each kit), crp (each kit), urine analysis reagent strip (as per packing), multistick (10 parametre) (as per packing), uri stick (2 parametre) (as per packing), pregnancy kit (pack of 100), widal kit (5 x 4 ml) (pack of 100), malaria rapid (each), dengue ns1 and igm combo kit (each), toxoplasma (rapid) (pack of 50), hepatitis b card test (tridot) (pack of 100), hepatitis b elisa method (pack of 50), hepatitis b card test (each card), hepatitis c card test (each card), hepatitis c elisa method (each ), troponin-i (pack of 10), h2s strip (each), biochemistry reagents (fully auto analyzer)erba em-200, blood sugar (lab method) (10x44 ml), blood sugar (glucometer strip) (pack of 100), blood sugar (10 x 44 ml), blood sugar (hexo kinase) each, blood urea (5 x 44 ml), s. creatinine jaffe s kinetic (5 x 44)ml, s. creatinine enzymatic (5 x 30 / 5 x 10 ml, s.bilirubin (t) (6 x 44) ml, s.bilirubin (d) (6 x 44) ml, sgot (6 x 44) ml, sgpt (6 x 44) ml, s.alkaline phosphatase (2 x 44) ml, s.alkaline phosphatase (2 x 22) ml, serum total protein (10 x 44) ml, serum albumin (10 x 44) ml, s. calcium (10 x 12) ml, s. amylase ( 5 x 22) ml, s. uric acid ( 5 x 44) ml, s. cholesterol (10 x 44) ml, s. triglyceride (5 x44) ml, s. triglyceride (5 x 22) ml, ldl-c (direct) (2 x 30) ml, s. hdl (4 x 30) ml, s. lipase (1 x 44) ml, ldh (2x44)ml, s. phosphorus, aso quantitative, crp quantitative, hb aic xl, magnesium estimation kit, serum iron, uibc, ferritin, ck-mb 2.11 ml, micro albumin, micro protein (10 x 12) ml, erba easylite machine (electrolyte), sodium electrode, potassium electrode, chloride electrode, membrane kit, tubing kit, electrolyte pack, electrolyte cleaning solution, internal filling solution, reference electrode, sample detector, wash solution, trilevel controls, other consumables, glass slide (grease free) 50ml (pack of 50), micro tips (yellow/ blue) (each), urine contrainer 50 ml (each), nverta k3 2ml vccume contanier (each), nvedta k2 2ml vccume contanier (each), plain vial vaccume contanier (each), yellow gel tube 4 x 5 ml (or 5ml) (each), sodium citrate tubes vaccume contanier (each), test tube (big) 12 x100 (each), test tube (glass) 18 x 150 (each), test tube (small) 12 x 75 (each), test tube stand (each), test tube holder (each), clotting vial vaccume contanier (each), esr stand (each), esr tube disposable (each), micro pipette(10-200) (each), micro pipette(5-50) (each), micro pipette(10-100) (each), micro pipette(100-1000) (each), tissue paper roll (each), fluoride vial vccume contanier (each), spirit lamp (each), disposable wintrobe tubes for esr (each), capillary tubes (each), cover slips (24 x60 mm) (

Diluting Fluid Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector