Web Analytics Made Easy - StatCounter

Diluting Fluid Tenders

Get complete information related to latest Diluting Fluid Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Diluting Fluid Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Diluting Fluid Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

State Government

CTN :39856264 Due date: 15 Apr, 202515 Apr, 2025 184
Tender For tenders are invited from the manufacturers/ dealers for the supply of chemicals/glassware/ consumables of reputed brands required for applied zoology department for a period of one year. - wash bottle- az, coplin jar- az, handypette - az, pipette bulb- az, dropping bottle 1- az, dropping bottle 2- az, measuring beaker with handle 1- az, measuring beaker with handle 2- az, measuring beaker with handle 3 - az, beakers 4-az, beakers 5-az, beakers 6-az, beakers 7-az, beakers 8- az, test tubes- az, watch glass 2- az, embryo cup- az, pasture pipette - az, pipette pump 3- az, beaker 11- az, beaker 22- az, beaker 03- az, beaker 04- az, beaker 05 - az, test tube rack - az, hand gloves - az, insect catching net - az, test tube washing brush 1- az, buratte stand- az, lancet- az, micro spin magnetic stirring bar 2 - az, alluminium foil - az, tissue paper roll- az, blotting paper 01- az, benidicts reagent qualitative-az, benidicts reagent quantitative-az, biurate reagent-az, blotting paper-az, borax-az, measuring cylinder 11-az, measuring cylinder 22-az, measuring cylinder 33-az, measuring cylinder 44-az, measuring cylinder 55-az, measuring cylinder 66-az, measuring cylinder 77-az, conical flask 11-az, conical flask 22-az, conical flask 33-az, watch glass 22-az, glass droppers 2-az, morter and pestile-az, micro slides 1-az, micro slides 2-az, spirit lamp-az, test tube holder-az, beakers 11-az, beakers 2-az, beakers 3-az, dmso.dimethylsulfoxide.-az, dna isolation kit-az, dpx moutant-az, drosofila culture bottel -az, ethanol molecular biological grade-az, ethidium bromide -az, fbs -az, ferroin indicator solution-az, ferroin solution .ar.-az, ferrous ammonium sulfate-az, dichlorofluorescein 2,7 -az, acetocarmine-az, agar agar .bacteriological.-az, agarose-az, amino acid kit-az, ammonium ferrous sulfate-az, ammonium hydroxide solution-az, ammonium metavandate-az, ammonium persulphate-az, ammonium sulphate-az, anesthetic ether -az, anthrone-az, ascorbic acid-az, aspartic acid-az, barfords reagent -az, n.hexane - az, nin.hydrine - az, nitric acid .ar grade. - az, tolidine o - az, bromophenol blue - az, cerrous ammonium sulphate - az, cholestrol - az, colchicine - az, creatinin - az, creosote oil-az, cupric chloride-az, cylophosphamide-az, dipottasium hydrogen phosphate-az, disodium hyderogen phosphate-az, dmem media-az, lugol solution - az, may grenwalds stain - az, megnesium sulfate - az, merthyl orange indicator - az, methyl red indicator - az, methyl salycilate - az, mtt - az, n. butanol - az, naphthyl ethylinediamine dihydrochloride reagent - az, nessler.s reagent - az, phosphoric acid-az, pipette pump-az, pms.phenazine methosulfate-az., pnpp.para.nitrophenly phosphate disodium.-az, potassium dichromate-az, potassium dihydrogen phosphate-az, potassium hydrodide-az, pottasium dihydrogen phosphate.kh2po4.-az, pottasium hydrogen phosphate.k2hpo4-az., propionic acid-az, rbc diluting fluid-az, rpmi 1640 media-az, saline citrate-az, peptone-az, perchloric acid - az, petroleum ether - az, ph buffer capsules . 7.0 0.05. - az, food adulteration kit - az, glycerol - az, haematoxylin - az, hbss - az, hypochlorite - az, indigo carmine - az, isopropanol - az, leishman stain - az, sodium di.hydrogen phosphate-az, sodium hydroxide-az, sodium phosphate dibasic dihydrate-az, sodium potasssium tartarate-az, sodium succinate-az, stanous chloride-az, starch-az, sulphanilamide-az, sulpho salicylic acid-az, sulphuiric acid -az, thiurea-az, toluene -az, trichloro acitic acid.tca.-az, tris buffer-az, trisodium phosphate -az, wagners reagent-az, wbc diluting fluid-az, whatman filter paprer cat no.1001.125-az, whatman filter paprer cat no.1001.150-az, whatman filter paprer cat no.1001.185-az, benzene 1-az, ph buffer capsules .4.0 0.05.-az, ph buffer capsules .9.2 0.05.-az, phenol solution-az, phenopthalein indicator-az, phenyl alanine 4-az, potassium iodide 1-az, potassium permanganate 2-az, sodium azide 2-az, sodium chloride 2-az, sodium sulphate 3-az, sucrose 2-az,

CTN :39858836 Due date: 18 Apr, 202518 Apr, 2025 NA
Tender For supply of cement 43 grade opc , coarse sand free from vegetation , coarse aggregate 20mm graded , coarse aggregate 40mm graded , hardcore 63 to 90 mm graded , aac blocks of size 600x200x150mm , mild steel bars of size 8 mm dia , mild steel bars of size 10 mm dia , mild steel bars of size 12mm dia , mild steel bars of size 16 mm dia , ms binding wire , wooden plank for shuttering ii class wood of size 3.0 x0.3 x0.026 m , acrylic emulsion paint of approved brand on new concrete surface , wooden scantling various size , oil bound distemper washable quality , wooden log for prop , synthetic enamel paint , painting brush 4 inch , nails various sizes , ms rhs of size 96x48x4 , ms plate of size 8mm thick , ms nuts and bolts of length 100mm fully thread suitable for 10 mm dia , ppgi sheet 0.55 mm thick of size10ft x3 ft , ppgi ridge sheet of 0.63mm thick of 90cm wide , self taping steel screw half thread with rawl plug , hdpe sand bags og colour of size 0.75x0.375x0.15 , anti corrosive red oxide zinc chromate primer , white lime , waterproofing compound , cement based paint , door of size 3x2.1 mtr double leaf , ventilator with grill 600x450mm , birla white wall care putty , ceramic tiles of size 600x600mm , white cement , curtain arrangement , movable pvc panel 12mm thick , app based polymeric membrane , priming surface and applying bitumen , brick sub class b , three phase 1.2 hp monoblock pump 430 volt complete , mild steel bars of size 12mm dia , air termination single pointed aluminium rod 12 mm dia and 300 mm long , testing point terminal block make of gun metal , aluminium strips 25 x 3.0 mm , galvanized iron strip 32 x 6 mm , earthing plate 600 x 600 x 6 mm , charcoal , salt normal , ci earth pit cover of size 300 x 300 x 6 mm , nut bolt 6mm dia 30 mtr dia with check nut and washer , gi pipe 40mm dia mtr 2.5 mtr , insulating pvc block 75x75x30 mm with insulating clamp nut and bolt , cement opc 43 grade packed , coarse sand free from vegetation , coarse aggregate 40mm graded , stone boulder 99 inch to 12 inch , pvc pipe 75mm dia 3 mtr long , distribution box 8 way double door spn 240 volts , mcb spn 240 volts 32 amps , mcb sp 240 volts 6 to 32 amps , pvc tape 19mm wide 5m long , cable pvc insulated electric 1.5 sqmm single core , cable pvc insulated of size 2.5 sqmm single core , cable pvc insulated 4 sqmm single core , pvc casing capping 1 inch , pvc casing capping 3 by 4 inch , switch piano type 5a 230v flush type one way , led tube light fittings 15w 230v , led mirror lights 1 feet 5 watts , screw 6x19mm isi marked , pvc switch board 6 inch by 6 inch , pvc switch board 7 inch by 4 inch , pvc switch board 8 inch by 10 inch , pvc l bend and t , modular switch socket combination 15a 230v , service bracket 40mm dia , service cable insulated aluminium conductore 10 sqmm 2 core , ceiling rose three terminal , led bulk head fittings high pressure die cast , pvc flexible wire copper conductor multi strandard , pvc flexible conduit pipe 15mm dia , pvc round or square block , exhaust fan of 230 volts 300mm seeep , fire exitingusher of 1kg capacity of dry powder type , earthing plate 600x600x6mm gi , ci earth pit cover of size 300x300x6mm with angle iron , funnel fitted with 20mm dia gi pipe 1.5m long , gi wire 4mm dia for earthing. , charcoal. , salt normal. , individual standalone plastic body smoke alarm , individual standalone plastic body heat alarm , fire ball extinguisher of 1.3 kg wt , study chair of size length 56 cm , study table , looking mirror of selected quality frameless , bid details/ 2 / 70 peg set of six , water dispenser of 230 v 500 watts , manual kero room heater 60cm height , labour charge

CTN :39872866 Due date: 19 Apr, 202519 Apr, 2025 NA
Tender For supply of poly bags of 50 kg each , sand coarse , stone aggregate coarse 20mm , stone aggregate coarse 40mm , stone aggregate coarse 40 to 63mm , tmt bar fe 550 grade 10mm dia , water proofing compund , gi binding wire , wooden planks for shuttering iind class wood , pcc solid block of size 400x200x200 , cement based paint , oil bound distemper , app based polymeric membrane , priming surface and applying bitumen , wooden scantling various sizes , steel props , nails all sizes , door size 2100x1200m double leaf , loop holes 1000 x 300 mm , prefab jally made up of isa 30x30x3mm and 24x25x3mm of size 900x900. , cement 43 grade opc packed in hdpe bag each 50 kg , coarse sand free from vegetation , coarse aggregate 20mm graded , coarse aggregate 40mm graded , hardcore 63 to 90 mm graded , aac blocks of size 600x200x150mm , mild steel bars of size 8 mm dia , mild steel bars of size 10 mm dia , mild steel bars of size 12mm dia , mild steel bars of size 16 mm dia , ms binding wire , wooden plank for shuttering , oil bound distemper , acrylic emulsion paint of approved brand , wooden scantling various size , wooden log for prop of size 3 mtr long 100 mm dia , synthetic enamel paint , painting brush 4 inch , nails various sizes , ms rhs of size 96x48x4.0 mm , ms plate of size 8mm thick , ms nuts and bolts , ppgi sheet 10ft x3 ft , ppgi ridge , self taping steel screw , hdpe sand bags og colour of size 0.75x0.375x0.15 , door of size 3x2.10m , door of size 1.80x2.10m , ventilator with grill of size 600x400mm , gate of size 3x2 mtrs , anti corrosive red oxide , white lime , waterproofing compound , cement 43 grade opc packed in hdpe bag each 50 , brick sub class b , three phase 1.2 hp monoblock pump , air termination single pointed aluminium rod 12 mm dia and 300 mm long. , aluminium strips 25 x 3.0 mm , galvanized iron strip 32 x 6 mm , earthing plate 600 x 600 x 6 mm , salt normal , nut bolt 6mm dia 30 mtr dia with check nut and washer , gi pipe 40mm dia mtr 2.5 mtr , insulating pvc block 75x75x30 mm , non woven geotextile 500gsm , 2 mm thick pvc p water proofing membrane. , high quality adhesive for termination of pvc water proofing membrane , cement opc 43 grade packed in hdpe bag each 50 kg , coarse sand free from vegetation , coarse aggregate 40mm graded , stone boulder 9 inch to 12 inch , pvc pipe 75mm dia 3 mtr long , labour charge

State Government

CTN :39826251 Due date: 10 Apr, 202510 Apr, 2025 50.00 Lacs
Tender For lab reagents supply work at govt base hospital kotdwara - items articals for lab, binocular microscope with lens, electrolyte (na+,k+,ca+) pack, esr disposable westergren tube, esr stand wintrobe, esr stand westergren, spirit lamp, test tube rack (aluminium), slide box, hot air oven, incubator, stethoscope, blood pressure machine, physical balance &weight box, rh viewing box(electrical), photocaloriemeter, oil immersion lens 100x, stopwatch, timer, vdrl shaker with timer, semi auto analyser, antisera abd, acetone, acetic acid glacial, ammonia solution, ammonium sulphate powder, ammonium oxalate powder, auto pipette 5-50ul, benedicts solutionqualitative, benedicts solution quantitative, brush test tube, barium chloride 10%, conc . hcl, conc. h2so4, conc hno3, carbol fuchsin, test tube rack aluminium, high power lens 40x, low power lens, auto pipette 50-200ul, auto pipette 1000ul`, auto pipette 500ul, auto pipette 10ul, dropping bottle plastic 1000ml, neubaver counting chamber, disodium hydrogen phosphate, dropping bottle plastic125 ml, distilled water, eosin powder, edta powder, ethenol, eherlichs reagent, aec diluting fluid, edta vial, esr filling needle, fouchets reagent, filter paper, beaker plastic 100-1000ml, beaker glass 100-1000ml, centriguge tubes, glass test tube 12*75, glass test tube 12*100, glass cover slip, glass slide, glass capillary tube, glass haemoglobinometer, hb measuring tube 2-20%, glass pipette for hb 20ul, glass rbc pipette, glass wbc pipette, glass funnel, glass marking funnel, grams iodine, hydrogen peroxide, washing solution, pm kit (semi auto), am kit ( semi auto), glass cover slip, vacutainer vial red top, vacutainer vial, vaccutainer needles, aliquet 2ml, fluoride vials, sodium citrate vials, glass wbc pipette, glass funnel, dengue ns1ag/igm/igg card test, leishman stain, liquid paraffin, litmus paper red, litmus paper blue, methylene blue, multisticks for urine exam, malaria antigen card test, mountex ppd vial, n/10 hcl, pregnancy card test, typhoid dotigm/igg, vdrl card test, hbsag card test, hcv tridot, hiv tridot, urinometer glass, wintrobe esr tube, westergren esr tube, platelet diluting fluid, potassium oxalate, potassium dichromate, plastic washing bottle 250 ml, plastic stand, plastic funnel, pasteur pipette, potassium permagnate, printer roll/ paper, plane vial, edta vial, rubber bulb, rbc fluid, wbc fluid, sodium sulphate powder, sulphur powder, tips auto pipette white, tips auto pipette yellow, tips auto pipette yellow, semen diluting fluid, sodium hypochloride solution, tourniquette strong, tissue paper, uristicks for albumin sugar, urine collection pot disposable, wintrobe tube filler, xylene, liquor ammonia, acetone, aso latex slide test, raf latex slide test, crp latex slide test, rapid pap stain, diamond glass marker, gram stain, fnac plunger, ethanol, coverslip for fnac, mgg stain, gills haematoxylin stain, og / ea stain, 1% glacial acetic acid, wbc count fluid/ turk fluid, giemsa stain, spirit lamp, occult blood card test, water bath, thermameter

Central Government/Public Sector

CTN :39835162 Due date: 16 Apr, 202516 Apr, 2025 NA
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39812946 Due date: 01 Apr, 202501 Apr, 2025 95.00 Lacs
Tender For e-tender document for supply of anti algae compound/ boilerdosing compound/ descaling compound / water treatment / rochemical at jaipur dairy-anti algae compound / condenser dosing with descalent, anti scalent (make: - albatros / thermax/ ion exchange/sagar technochem/satol)(i) antiscaling(ii) anti alage -i(iii) anti alage -ii2boiler dosing compound- (make: - albatros / thermax/ ion exchange/ sagar technochem/satol)(i) with oxygen scavengers(ii) with ph booster & sludge conditioner3descaling compound (make: albatross/thermax/ion exchange/ sagar technochem/satol)the de-sealing compound is to be used to remove scale deposits from the syatem/equipment boiler, heat exchanger/condenser quickly, safely and efficientlythe percentage (%) of de-scaling compound/chemical to be used per 1000 lit of water should be mentioned.the chemical should be non corrosive& the metal loss should be zero4water treatment chemical: - (make: albatross/thermax/ion exchange/ sagar technochem/satol)(i) antiscalant & stabilizer controls(ii) ph booster as an alkaline buffer(iii) smbs (de chlorination) removal of free chlorine and as a biostatic5ro treatmet chemical (make: albatross/thermax/ion exchange/ sagar technochem/satol)(i) antiscalant(ii) cip chemical :-(a) alkaline based(b) citric based(c) controol of bacteria fouling(d) chlorine scavenger

CTN :39816531 Due date: 15 Apr, 202515 Apr, 2025 NA
Tender For supply of construction material of mor pit - cement and all other specification as per rfp , coarse sand free from vegetation and all other specification as per rfp , coarse aggregate and all other specification as per rfp , stone boulder and all other specification as per rfp , water proofing compound and all other specification as per rfp , quick setting compound and all other specification as per rfp , slack lime and all other specification as per rfp , painting brush and all other specification as per rfp , hdpe sand bag and all other specification as per rfp , anti corrosive red oxide and all other specification as per rfp , synthetic paint and all other specification as per rfp , thinner and all other specification as per rfp , srt and all other specification as per rfp , ismb hot rolled and all other specification as per rfp

CTN :39774434 Due date: 12 Apr, 202512 Apr, 2025 NA
Tender For supply of cement 43 grade opc packed in hdpe bag each 50 kg wt conform to is 8112 1989 make birla gold or ambuja or ultratech or acc or jk or dalmia , coarse sand free from vegetation , coarse aggregate 20mm graded , coarse aggregate 40mm graded , coarse aggregate 40 to 63 mm graded , stone boulders 9 inch to 12 inch , mild steel bars of size 8 mm dia conform to is 432 part 1 1982 tmt bar make tata or sail or jsw , water proofing compound conform to is 2645 2003 make pidilite or dr fixit or fevicol , pbs roll 20m long width of 0 point 9mtr isi marked with min weight of 34 kgs roll , gi binding wire tata sail jsw , cement base paint scowcem make berger or asian or nerolac , slack lime , painting brush 4 inch isi marked , hdpe sand bag of size15 inch x 30 inch , anti corrosive red oxide zinc chromate primer confirming to is 5 2004 make berger or asian or nerolac , synthetic paint enamelled og confirming to is 5 2004 make berger or asian or nerolac , thinner make nerolac or berger or asian , srt 2440 x 613 x 180 2 mm thick ms sheet hot rolled steel with nuts and bolts incl one coat of red oxide make tata or sail or jsw , srt 1840 x 613 x 180 2 mm thick ms sheet hot rolled steel with nuts and bolts incl one coat of red oxide make tata or sail or jsw , ismb hot rolled ms 200 x 100x 4m make tata or sail jsw , prefeb mild door steel of size 750x 1800mm double shutter outer frame isa 40x40x6mm and door shutter isa 35x35x5mm isa 30x30x3mm 0 point 75 m x 1 point 8 m double shutter tata sail jsw , mild steel bars of size 10 mm and above dia conforming to is 432 part i 1982 make tata or sail or jsw , loop holes 780 x 300 mm make tata or sail or jsw , loop holes 1000 x 300 mm make tata or sail or jsw , loop holes 1250 x 350 mm make tata or sail or jsw , ventilator steel 600x450 mm isa 30x30x3mmand 1 mm isa 35x35x6mm and tower bolt 8mm dia 75 mm long make tata sail jsw , wooden plank for shuttering ii class wood of size 3 x0 point 3 x0 point 026 m , wooden scantling various size , nails various sizes , air terminatoin single pointed aluminium rod 12mm dia and 300mm long. , testing point terminal block made of gun metal and phosphorus bronze size 75x75x25mm drilled and screwed including 3 nos 8mm dia 25mm long hexagonal head screw , aluminium strips 25x3mm , galvanised iron strip 32x6mm , funnel fitted with 20mm dia gi pipe 1 point 5m long make jindal or tata or kalinga , earthing plate 600x600x6mm gi steel suitable for gi strip fittings drilled with two nos holes for 6 mm dia near one side , ci earth pit cover of size 300x300x6mm with angle of size 20x20x3mm thick with ms frame , charcoal , salt , insulating pvc block 75x75x30 mm with insulating clamp nut and bolt make presto or polycab or finolex

CTN :39774435 Due date: 12 Apr, 202512 Apr, 2025 NA
Tender For supply of cement 43 grade opc packed in hdpe bag each 50 kg wt conform to is 8112 1989 make birla gold or ambuja or ultratech or acc or jk or dalmia , coarse sand free from vegetation , coarse aggregate 20mm graded , coarse aggregate 40mm graded , coarse aggregate 40 to 63 mm graded , stone boulders 9 inch to 12 inch , mild steel bars of size 8 mm dia conform to is 432 part 1 1982 tmt bar make tata or sail or jsw , water proofing compound conform to is 2645 2003 make pidilite or dr fixit or fevicol , pbs roll 20m long width of 0 point 9mtr isi marked with min weight of 34 kgs roll , gi binding wire tata sail jsw , cement base paint scowcem make berger or asian or nerolac , slack lime , painting brush 4 inch isi marked , hdpe sand bag of size15 inch x 30 inch , anti corrosive red oxide zinc chromate primer confirming to is 5 2004 make berger or asian or nerolac , synthetic paint enamelled og confirming to is 5 2004 make berger or asian or nerolac , thinner make nerolac or berger or asian , srt 2440 x 613 x 180 2 mm thick ms sheet hot rolled steel with nuts and bolts incl one coat of red oxide make tata or sail or jsw , srt 1840 x 613 x 180 2 mm thick ms sheet hot rolled steel with nuts and bolts incl one coat of red oxide make tata or sail or jsw , ismb hot rolled ms 200 x 100x 4m make tata or sail jsw , prefeb mild door steel of size 750x 1800mm double shutter outer frame isa 40x40x6mm and door shutter isa 35x35x5mm isa 30x30x3mm 0 point 75 m x 1 point 8 m double shutter tata sail jsw , mild steel bars of size 10 mm and above dia conforming to is 432 part i 1982 make tata or sail or jsw , loop holes 780 x 300 mm make tata or sail or jsw , loop holes 1000 x 300 mm make tata or sail or jsw , loop holes 1250 x 350 mm make tata or sail or jsw , ventilator steel 600x450 mm isa 30x30x3mmand 1 mm isa 35x35x6mm and tower bolt 8mm dia 75 mm long make tata sail jsw , wooden plank for shuttering ii class wood of size 3 x0 point 3 x0 point 026 m , wooden scantling various size , nails various sizes , air terminatoin single pointed aluminium rod 12mm dia and 300mm long. , testing point terminal block made of gun metal and phosphorus bronze size 75x75x25mm drilled and screwed including 3 nos 8mm dia 25mm long hexagonal head screw , aluminium strips 25x3mm , galvanised iron strip 32x6mm , funnel fitted with 20mm dia gi pipe 1 point 5m long make jindal or tata or kalinga , earthing plate 600x600x6mm gi steel suitable for gi strip fittings drilled with two nos holes for 6 mm dia near one side , ci earth pit cover of size 300x300x6mm with angle of size 20x20x3mm thick with ms frame , charcoal , salt , insulating pvc block 75x75x30 mm with insulating clamp nut and bolt make presto or polycab or finolex

CTN :39774538 Due date: 12 Apr, 202512 Apr, 2025 NA
Tender For supply of cement 43 grade opc , coarse sand free from vegetation , coarse aggregate 20mm graded , coarse aggregate 40mm graded , hardcore 63 to 90 mm graded , aac blocks of size 600x200x150mm , mild steel bars of size 8 mm dia , mild steel bars of size 10 mm dia , mild steel bars of size 12mm dia , mild steel bars of size 16 mm dia , ms binding wire , wooden plank for shuttering ii class wood of size 3.0 x0.3 x0.026 m , acrylic emulsion paint of approved brand on new concrete surface , wooden scantling various size , oil bound distemper washable quality , synthetic enamel paint , steel props , water proofing compound , painting brush 4 inch , nails various sizes , ms rhs of size 80x40x3.2 , ms plate of size 8mm thick , ms nuts and bolts of length 100mm fully thread suitable for 10 mm dia , ppgi sheet 0.55 mm thick of size10ft x3 ft , ppgi ridge sheet of 0.63mm thick of 90cm wide , self taping steel screw half thread with rawl plug , hdpe sand bags og colour of size 0.75x0.375x0.15 , door of size 3x2.1 mtr double leaf , door of size 1.8x2.10 mtrs , ventilator with grill 600x400mm , gate of size 3x2 mtrs double leaf , anti corrosive red oxide zinc chromate primer , white lime , waterproofing compound , cement based paint , brick sub class b , three phase 1.2 hp monoblock pump 430 volt complete , air termination single pointed aluminium rod 12 mm dia and 300 mm long , testing point terminal block make of gun metal , aluminium strips 25 x 3.0 mm , galvanized iron strip 32 x 6 mm , earthing plate 600 x 600 x 6 mm , charcoal , salt normal , ci earth pit cover of size 300 x 300 x 6 mm , nut bolt 6mm dia 30 mtr dia with check nut and washer , gi pipe 40mm dia mtr 2.5 mtr , insulating pvc block 75x75x30 mm with insulating clamp nut and bolt , non woven geotextile 500gsm as seperation layer between wall and pvc , 2 mm thick pvc p water proofing membrane. , non woven geotextile 500gsm as protective layer , non woven geotextile 500gsm as seperation layer , non woven geotextile 500gsm as seperation layer between deck slab and pvc , 2 mm thick pvcp water proofing membrane. , non woven geotextile 500gsm as protective layer of pvc waterproofing , high quality adhesive for termination of pvc water proofing membrane , cement opc 43 grade packed , coarse sand free from vegetation , coarse aggregate 40mm graded , stone boulder 99 inch to 12 inch , pvc pipe 75mm dia 3 mtr long , labour charge
 Loading, Please wait...

Connect us via What's Up