Web Analytics Made Easy - StatCounter

Ether Tenders

Get complete information related to latest Ether Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Ether Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Ether Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

CTN :39730459 Due date: 04 Apr, 202504 Apr, 2025 NA
Tender For corrigendum : supply of supply of ethernet siwtch as per soj-stc , supply of wan routers as per soj-stc , supply of licensed ecscada server software at jaipur, upgradation of existing scada license (perpet , upgradation of ecscada software at mundra abd ews locations, network confguration services of ether

CTN :39858766 Due date: 18 Apr, 202518 Apr, 2025 NA
Tender For supply of lanthanum chloride , ammonium sulphamate , iodine resublimed , potassium carbonate , napthanol ar , methanesulfonic acid s , phthalein purple , methylene blue , orthophosphoric acid , mercuric iodide red , tin chloride dihydrate , bovin albumin , formic acid , formaldehyde solution , methanol hplc , diethyl ether

Central Government/Public Sector

CTN :39835162 Due date: 16 Apr, 202516 Apr, 2025 NA
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39320533 Due date: 28 Mar, 202528 Mar, 2025 20.23 Lacs
Tender For bid to ras supply of ether solvent , ketamine hcl 50 mg oblique ml 2 ml inj , thiopentone inj of 0point5 g without water for injection , bupivacaine hcl 5 mgobliqueml 20 ml inj , bupivacaine hcl 5 mgobliqueml heavy 4 ml inj , lignocaine hcl 2percent without adrenaline 30 ml inj suitable for ophthalmic use also , lignocaine hcl 2percen with adrenaline , lidocaine oblique lignocaine hcl 2percent with adrenaline , atropine sulphate 0point6 mg 1 ml inj , peracetic acid bott of 810 gm , diclofenac sodium suppository 100 mg , indicator soda lime , paracetamol with cysteine hcl monohydrate infusion 1000mgoblique100ml , common cold tab antihistiminics plus paracetamol 500 mg without pseudoephedrine , etoricoxib 120 mg tab , piroxicam 20 mg tab , fentanyl citrate 50mcgoblique ml 2 ml inj , fentanyl 50mcgoblique ml 10 ml inj , morphine 15 mg 1 ml inj , indomethacin 75 mg sr tab , indomethacin 25mg tab oblique cap , ketorolac 10 mg tab , tramadol hcl 50 mg cap oblique tab , betamethasone 4mg 1ml inj , adrenaline tartrate 1 isto 1000 coma 1 ml inj , levo des cetrizine 5mg tab , dexamethasone 0point5 mg tab , pheniramine maleate inj 22point75 mg per ml amp of 2 ml , methylprednisolone 16 mg tab , promethazine hcl 2point5 percent 25mgm oblique ml 2 ml inj , levetiracetam 100mg oblique ml vial of 5 ml inj , piracetam 400 mg tab , oxcarbazepine 150 mg tab , carbamazepine 200 mg tab , clonazepam 2 mg tab , lorazepam 2mg oblique ml 2 ml inj , diazepam 5 mg tab , lamotrigine 25 mg tab , lamotrigine 50 mg tab , sumatriptan 50 mg tab , topiramate 25 mg tab , rizatriptan 5 mg tab , baclofen 10 mg tab , acebrophylline 100 mg cap , budesunide 1 mg respules , carbimazole 20 mg tab , ethambutol 1200 mg tab , mycophenolate mofetil 250 mg tab , diethylcarbamazine 50mg tab , clofazimine 100mg cap , rifampicin 150mg cap , rifampicin 600 mg plus tab inh 300mg tab , ethambutol 200mg tab , isoniazid 300 mg tab , chloroquine phosphate 250mg tab , primaquine 7point 5mg base tab , silver sulphadiazine 1 percent ointment 20 gm tube , azathioprine 50mg tab , cyclosporine a micro emulsion 25 mg cap , hydroxyurea 500 mg cap , methotrexate 5 mg tab , inj goserelin 3point6 mg prefilled syringe zoladex 3point6 mg , letrozole 2point5 mg tab , levodopa 100 mg and carbidopa 25 mg tab , amantadine 100 mg cap , cabergoline 0point5 mg tab , rasagiline 1mg tab , trihexyphenidyl hcl 2 mg tab , tab levodopa 125 mg , tab levodopa cr 250 mg , tab topiramate 50mg , tab pregablin 75 mg , ferric hydroxide sucrose complex 20 mg in 5ml for injection , erythropoeitin human recombinant 2000 iu , tranexamic acid 500 mg oblique 5ml inj , phytomenadione vit k 1 mg oblique 0point5 ml inj , prasugrel 10 mg tab , fenofibrate 160 mg tab , carvedilol 3point125mg tab , diltiazem 60 mg tab , diltiazem controlled delivery 90mg tab , fenofibrate 200 mg tab , isosorbide dinitrate 10 mg tab , isosorbide mononitrate 20 mg tab , tab perindopril 8mg , esmolol 100 mg 10 ml inj , prasugrel hcl 5 mg tab , lignocaine hcl solution 2percent for iv use 50 ml inj , enalapril maleate 10 mg tab , enalapril maleate 2point5 mg tab , nebivoilol 5mg tab , labetalol hcl 100 mg tab , metoprolol 1 mg oblique ml 5 ml inj , nifedipine retard 20 mg cap oblique tab , propranolol tr 40 mg tab , ramipiril 2point5 mg tab , digoxin 0point25 mg tab

CTN :39697186 Due date: 29 Mar, 202529 Mar, 2025 NA
Tender For corrigendum : supply of etp chemicals and consumables-, antiscalent chemical for ro membrance (water palnt), antiscaling chemical with ph booster for 5mt boiler dosing, ink cartridges, makeup cartridges, cleaning solution, etp chemicals, hydrochloric acid (hcl), sulphuric acid, lr grade, 05 ltrs pack, k2cr207potassium dichromate er 500 gr pack, ferroin indicator, 100 ml pack, mercuric sulphate,250 gr pack, silver sulphate, 25 gr, petroleum ether,2.5 ltrs , sodium azide 100 gr , manganous sulphate 500 gr , manganoussulphatemonohydratesq 500g, ferric chloride250 gr , calciumchloride250 gr , hcl250 ml , starch500 gr , ferrous sulphate500 gr , whatman filter paper 40 no - 01 no's, whatman filter paper, 41 no-01 no's, normal filter paper 1mx1m- 02 no's (10 sheets), sodium hydroxide pellets250 gr , sodium iodide100 gr , sodium thiosulphate500 gr , kh2p04 (potassium dihydrogen o phosphate) 250 gr, na2hp04sodium phosphate monobasic anhydrous er 250 gr, buffer solution ph 4.0 , buffer solution ph 7.0 550ml , buffer solution ph 9.2 550ml , ferric alum, pac, dap , hypochlorite , urea

Central Government/Public Sector

CTN :39774589 Due date: 12 Apr, 202512 Apr, 2025 NA
Tender For supply of chemicals and consumables - oxalic acid graterthan 99point5 percent cas 6153-56-6 , 2 4 dinitrophenol 99 percent cas 51-28-5 3x100gm , abts 2 2-azino-bis 3-ethylbenzothiazoline-6-sulfonic acid diammonium salt 30931-67-0 , acetylcholine chloride ar 1 pack of 10 g , ag agcl 3m kcl reference electrode basmf2056-1ea , ag 50w to x8 cat exch resin biotechnology grade 100 to200 mesh hydrogen form , al2o3 pl slurry 0.05meu 1pkt of 10g , al2o3 pl slurry 0.3meu 1pkt of 10g , al2o3 pl slurry 0.5meu 1pkt of 10g , aluminium foil 25micrometer 20 roll per piece 50m , ammonium fluoride ar acs assay 98 percent cas 12125- 01-8 1pack of 25 g , arsenic iii oxide ar assay 99 percent cas 1327-53-3 1pack of 500g , benzofuran for synthesis cas no 271896 b8002-25g , bis salicylaldehyde orthophenylene diamine reagent , bolds basal medium , boron trichloride 178934-100g , bromcresol green cas 76- 60-8 , bromcresol purple ar cas 115-40-2 , bromphenol blue ar cas 115-39-9 , cadmium nitrate tetrahydrate purified assay 99 percent cas 10022-68-1 1pack of 100 , cellulose acetate cas 9004-34-6 , cellulose powder, for column chromatography , centrifuge tube box polypropylene 15ml tarson polylab axiva , centrifuge tubes 50 ml 5 packets 200pc per pack , cetrimide agar , chitosan cas 9012-76-4 , cholchicine 64-86-8 , copper sulphate anhydrous cas no 12852-250g , cresol red ar, cas 1733- 12-6 , cuprous iodide 99 percent cas 7681-65-4 , curcumin grater than equal to 94 percent purity cas no 458-37-7 00280590-10 mg x2 00280590-10mg , curcuminoids 80 percent purity cas no 458-37-7 c7727-500mg , desicator vaccum polypropylene diameter 200mm tarson or polylab , dichloromethane 34856-1ltr , dimethylamine cas 124-40-3 , dmf cas no 68122 , dmso cas no 67-68-5 , dpph cas no 1898664 d9132-5gm , dulbecco phosphate buffered saline d5652-10x1l , eppenndorf-microcentrifuge tubes 1.5ltr , ethanol 99 percent , ethylenediaminetetraacetic acid disodium salt dihydrate , centrifuge tubes 15ml , folin and ciocalteu phenol reagent , formaldehyde cas no 50-00-0 252549-100ml , formic acid gr 98.0-100 percent cas no 64- 18-6 , furan for synthesis assay 99 percent cas 110-00-9 1 pack of 100ml , furfuraldehyde ar acs assay 99percent cas 98-01-1 1 pack of 500 , gallic acid 149-91-7 , glycerol 56-81-5 , graphite fine powder 98percent cas 16940-66-2 , high salt medium , hydrogen peroxide solution 30percent cas 7722-84-1 , icp multi-element standard solution iv sigma merck 23 elements in diluted nitric acid 1000 mg l ag, al, b, ba, bi, ca, cd, co, cr, cu, fe, ga, in, k, li, mg, mn, na, ni, pb, sr, tl, zn , immersion oil , in line syringe filter holder 25mm psf tarson or polylab or axiva , in line syringe filter holder 47mm psf tarson or polylab or axiva , iron oxide cas no 1309-37-1 , l-malic acid 99percent cas 97- 67-6 , lb broth , macconkey agar , mask , methyl diethanol amine cas 105-59-9 , methyl orange cas 547-58-0 3x100gm , methyl red cas 493-52-7 3x100gm , methyl yellow cas 60-11-7 3x100gm , mini spatula , n-methyl-2- pyrrolidone for hplc 99percent , naoh-solid cas no 1310732 6x1kg , neutral red ar cas 553-24-2 , nutrient agar , nutrient broth , p-nitrophenol ar cas 100-02-7 , parafromaldehyde cas 30525-89-4 , petroleum ether cas no 8032324 , phenol red sodium salt indicator cas 34487- 61-1 , phenolphthalein indicator cas 77-09-8 5 x100gm , phenyl boronic acid cas 98-80-6 1pack of 25g , pipette rack horizontal z shape polypropylene tarson or polylab oraxiva , pnpa-paranitrophenylacetate 2 bottle of 25g , polyvinylidene fluoride cas 24937-79-9 , polypropylene beaker garduated 500mltarson or polylab or axiva , polypropylene forcep , polypropylene measuring cylinder graduated class a 500ml tarson or polylab , potassium hydroxide 90 percent flakes 484016-1kg , potassium permanganate 238511-100gm , potassium persulphate 7727-21-1 , potassium sulphate cas no 7778805 223492- 500gm , potato dextrose agar , potato dextrose broth , ptfe stirrer 10 x 250mm , pyrrole for synthesis assay 97.

State Government

CTN :39776918 Due date: 27 Mar, 202527 Mar, 2025 52.95 Lacs
Tender For procurement of sodium lauryl ether sulphate (sles)

CTN :39792980 Due date: 14 Apr, 202514 Apr, 2025 NA
Tender For price agreement of medicines drugs lab items and surgical items for a period of one year - procurement, diethyl ether solvent bott of 500 ml, lignocaine hcl 2 percent (without adrenaline) 30ml inj (suitable for ophthalmic use also), lignocaine hcl 2 perecent with adrenaline (1:80000) 30ml inj, diclofenac 75 mg/ml, 1 ml amp inj, lignocaine 100mg& ethanol 28mg/ml v/v spray container of 500/800ml, lignocaine hcl jelly 2percent tube of 30 gm with sterile tube and short nozzle suitable for intra uretheral use, should be packed within a sterile blister pack, atropine sulphate 0.6mg, 1 ml inj, midazolam 5 mg, 1 ml inj, paracetamol 650 mg tab, aceclofenac 100 mg, paracetamol 500 mg tab, paracetamol 325 mg + diclofenac sodium 50 mg tab, diclofenac sodium sr 100 mg tab, paracetamol with cysteine hcl monohydrate infusion 1000 mg/100 ml, common cold tab (cetirizine 5-10 mg + paracetamol 500 mg + pseudoephedrine 30-60 mg), deflazacort 6 mg, tab, diclofenac sodium 50 mg, enteric coated tab, diclofenac 25mg/ml ip, 3ml inj, ibuprofen 200 mg tab, ibuprofen syrup 100mg/5ml bott of 50 ml, ibuprofen 400mg tab, paracetamol 10 mg/ml infusion in 100 ml bottle, diclofenac diethylamine 2.32% w/v, quick penetrating topical solution-30 ml bottle, with metered dose spray, naproxen 250mg tab, paracetamol 500mg tab, paracetamol 150mg/ml, 2 ml iv, inj, paracetamol syp 125mg/5ml bott of 60 ml, paracetamol 325mg and ibuprofen 400mg tab, etoricoxib 120 mg tab, piroxicam 20 mg tab, piroxicam 40mg, 2ml inj, morphine 15mg, 1 ml inj, indomethacin 75 mg sr tab, allopurinol 100 mg tab, indomethacin 25mg tab/cap, ketorolac10mg tab, tramadol hcl 50 mg cap/tab, tramadol hc 50 mg/ml inj, aceclofenac 100 mg tab, febuxostat 40 mg tab, adrenaline tartrate (1:1000), 1 ml inj, cetrizine-dihydrochloride 10 mg tab, levo-cetrizine 5mg tab, cyproheptadine 4 mg tab, fexofenadine 30mg/5ml in 60ml bottle, montelukast 10mg + levocetrizine 5mg tab, promethazine syp 5mg/5ml bott of 60 ml, dexamethasone 0.5 mg tab, dexamethasone sodium phosphate 4.4 mg (equivalent to dexamethasone phosphate 4 inj, pregabalin 75 mg + methylcobalamine 1500 mcg tab, hydrocortisone sodium succininate 100 mg inj, pheniramine maleate inj 22.75 mg per ml amp of 2 ml, nor adrenaline bitartrate 2 mg/ml, 2 ml inj, pheniramine maleate 25 mg tab, prednisolone 5 mg tab, promethazine hcl 2.5percent, 25mgm/ml, 2 ml inj, pralidoxime 500mg/20ml inj, n-acetyl cysteine 200 mg/ml, 5 ml ampoule, divalproate sodium 500 mg, tab, pregabaline 75mg cap, levetiracetam 500 mg tab, oxcarbazepine 150 mg tab, oxcarbazepine 300 mg tab, carbamazepine 200 mg tab, carbamazepine 200 mg cr tab, carbamazepine syp 100mg/5ml bottle of 100 ml, clobazam 5 mg tab, clonazepam 2 mg tab, lorazepam 2mg/ml, 2ml inj, diazepam 10 mg, 2 ml inj, donepezil 5 mg tab, diazepam syp 2 mg/5 ml bottle of 60 ml, diazepam 5 mg tab, gabapentin 300 mg cap, phenytoin oral suspension containing phenytoin 100mg/4ml bottle of 100 ml, phenytoin sodium 100 mg tab, sodium valproate oral solution 200mg/5ml bott of 100 ml, sodium valproate 200 mg tab, lamotrigine 25 mg tab, sumatriptan 50 mg tab, sumatriptan nasal spray 20 mg, 10 metered doses, topiramate 25 mg tab, rizatriptan 5 mg tab, baclofen 10 mg tab, budesonide 200mcg inhaler, budesonide 200 mcg + formeterol 6 mcg autohaler, budesunide 1 mg respules, canagliflozin 100 mg tab, carbimazole 20 mg tab, chlorzoxazone 500 mg + diclofenac sodium 50 mg + paracetamol 325 mg tab, salmeterol 25 mcg + fluticasone 250 mcg autohaler, diacerin 50 mg tab, doxophyllin 400 mg tab, mesalazine 500mg tab, albendazole 400 mg tab, albendazole syp each 5 ml containing 200 mg bott of 10 ml syp, sitagliptin 50 mg + metformin 500 mg tab, ivermectin 6mg tab, amoxycillin ip 500 mg cap, spacer device for inhaler, pyrantel pamoate 250 mg/5ml susp., diethylcarbamazine 50mg tab, amitriptylline 25 mg tab, itopride 50mg tab, rifampicin 450mg + isoniazed 300mg combination cap/tab, rifampicin 600 mg+tab inh 300mg tab, ethambutol 200 mg tab, isoniaz

State Government

CTN :39797545 Due date: 26 Mar, 202526 Mar, 2025 NA
Tender For quotation for molysol e annual repair-500ml moly--ethanol, petroleum ether 40-60-500 ml, whatman - filter paper no.1 12.5cm 1001-125, borosil -dishes culutre petri, s-li 100x15mm, adenine sulphate 10gm-molychem, tween 80-500ml-molychem, indole-3 butyric acid 25gm molychem, cotton bundle (absorbent) (500 gm) and ethanol annual repair 99.9% -500 mi

Central Government/Public Sector

CTN :39801952 Due date: 28 Mar, 202528 Mar, 2025 NA
Tender For under desk and cab door with side frame protection aluminium composite fr grade panelin g in wap7 loco as per specifications: aluminium composite panel sheet core composition: advanced miner al compounds with approximately 75% of composition, panel thickness: 3mm, aluminium skin thickness:0. 5 mm, fire performance classification: class b, flame propagation: restricted, tensile strength: >24 mpa f lexural strength: >50 mpa, peel strength: >5 n/mm, surface coating type: pvdf ( polyvinylidene fluoride ( pvdf)) or feve (fluoroethylene vinyl ether), coating thickness: 25 to 30 microns. make: city bond or mapl or eurobond fr grade acp. area: 500 sq.ft note: installation shall be within scope of supply by firm includin g all retro fitment as per cab requirement . [ warranty period: 30 months after the date of delivery ]
 Loading, Please wait...

Connect us via What's Up