Latest ether Tenders | Government ether Tenders

CTN :39873328

18 Apr, 2025 NA

Ambala - Haryana

Tender For supply of medicine - inj bleomycin sulphate 15 units vial , hydrocortisone acetate cream 1 percent ww tube of 15 gm , cap minocycline er 65 mg , tab minoxidil 2 point 5 mg , clobetasol propionate 0 point 05 percent w w plus buffered lactic acid 12 percent w w 30 gm gel , zinc oxide and benzalkonium chloride cream tube of 30 gram , 0 point 1 percent triamcinolone acetonide bucccal parts 7 point 5 gm tube , calcium pantothenate tablet 200 mg , lot padophyllin resin 20 percent bott of 10ml , tab acetretin 10 mg , clindamycin 1 percent w v benzoyl peroxide 5 percent w w gel 20gm , cyclophosphamide 500 mg inj , lot lactic acid 17 percent plus salicylic acid 17 percent bott of 15ml , lot ciclopirox 1 percent w v zinc pyrithidone 1 percent 100ml , cyclosporine eye drops 0 point 05 percent bott of 3 ml , ketorolac tromethamine 0 point 4 percent eye drops 5 ml , brimonidine tartrate 0 point 2 percent eye drops 5 ml , ctr nosule tension rings , microscope bulbs 15v 150w , moxifloxacin hcl 0 point 5 percent plus prednisolone 1 percent w v eye drop 5 ml , gatifloxacin hcl 0 point 3 percent plus prednisolone 1 percent w v eye drop 10 ml , malyugin ring , pva spears pkt of 10 , tropicamide 0 point 02 percent plus phenylephrine hcl 3 point 0 percent plus lidocain hcl 1 percent inj , iris hooks set of 5 , hydroxypropyl methycellulose hypermellose ups 3 gm carbomer 9802 point 2mg sorbitol dequest 2060 5slerile lubricant eye gel 10gm , fluriscein strip , acetazolamide 500mg tab , travoprost 0 point 004 percent with timolol 0 point 5 percent with polyquad 0 point 001 percent bottle with dispensing plug and screw cap eye drop bott of 2 point 5ml , tab tranexamic acid 250 mg , tab norethisterone 10mg , syp melatonin , ung betamethsone 0 point 64 mg plus salicylic acid 30 mg tube of 10 gm , syp metoclopramide 5mg ml bott of 60ml , doxepine 10mg cap , syp vitamin d3 drop 100 iu ml bott of 15ml , tab mycophenolate mofetil 750 mg , tab estradiol valerate 2mg pack of 28 , tab repaglinide 2mg , tab repaglinide 3mg , enterogermina bacillus clausii spores oral suspension 5 ml , tab estradiol hemihydrate 2 mg , syp risperidone2 ponit 5mg 5ml , tab bilastine 10 mg , ketotifen fumarate 0 point 005 percent eye drops 5 ml , atropine sulphate oint 1 percent tube of 3 gm , eye pad with patch , vitamin d3 400 iu ml drops 15ml , ether solvent , enema sodium phoshate ml 6 percent sod acid phoshate 16 percent pack of 100ml , calcium phosphate syrup 80 mg 5 ml 200 ml bottle , clotrimazole plus beclomethasone plus lignocaine plus chloramphenicol bott of 10 ml ear drop , pulv neomycin plus polymixin b bott 10gm , ung benzoyl peroxide 5 percent , tab repaglinide 1mg , inj methylcobalamine 500mcg , azithromycin 500mg inj , syp prednisolone 5 mg ml bott of 30 ml , levonorgestrel iu system , ung imiquimod 5 percent , bss ophthalmic irrigation solution 500 ml with unoport technology

State Government

CTN :39856264

15 Apr, 2025 184

Mangalore - Karnataka

Tender For tenders are invited from the manufacturers/ dealers for the supply of chemicals/glassware/ consumables of reputed brands required for applied zoology department for a period of one year. - wash bottle- az, coplin jar- az, handypette - az, pipette bulb- az, dropping bottle 1- az, dropping bottle 2- az, measuring beaker with handle 1- az, measuring beaker with handle 2- az, measuring beaker with handle 3 - az, beakers 4-az, beakers 5-az, beakers 6-az, beakers 7-az, beakers 8- az, test tubes- az, watch glass 2- az, embryo cup- az, pasture pipette - az, pipette pump 3- az, beaker 11- az, beaker 22- az, beaker 03- az, beaker 04- az, beaker 05 - az, test tube rack - az, hand gloves - az, insect catching net - az, test tube washing brush 1- az, buratte stand- az, lancet- az, micro spin magnetic stirring bar 2 - az, alluminium foil - az, tissue paper roll- az, blotting paper 01- az, benidicts reagent qualitative-az, benidicts reagent quantitative-az, biurate reagent-az, blotting paper-az, borax-az, measuring cylinder 11-az, measuring cylinder 22-az, measuring cylinder 33-az, measuring cylinder 44-az, measuring cylinder 55-az, measuring cylinder 66-az, measuring cylinder 77-az, conical flask 11-az, conical flask 22-az, conical flask 33-az, watch glass 22-az, glass droppers 2-az, morter and pestile-az, micro slides 1-az, micro slides 2-az, spirit lamp-az, test tube holder-az, beakers 11-az, beakers 2-az, beakers 3-az, dmso.dimethylsulfoxide.-az, dna isolation kit-az, dpx moutant-az, drosofila culture bottel -az, ethanol molecular biological grade-az, ethidium bromide -az, fbs -az, ferroin indicator solution-az, ferroin solution .ar.-az, ferrous ammonium sulfate-az, dichlorofluorescein 2,7 -az, acetocarmine-az, agar agar .bacteriological.-az, agarose-az, amino acid kit-az, ammonium ferrous sulfate-az, ammonium hydroxide solution-az, ammonium metavandate-az, ammonium persulphate-az, ammonium sulphate-az, anesthetic ether -az, anthrone-az, ascorbic acid-az, aspartic acid-az, barfords reagent -az, n.hexane - az, nin.hydrine - az, nitric acid .ar grade. - az, tolidine o - az, bromophenol blue - az, cerrous ammonium sulphate - az, cholestrol - az, colchicine - az, creatinin - az, creosote oil-az, cupric chloride-az, cylophosphamide-az, dipottasium hydrogen phosphate-az, disodium hyderogen phosphate-az, dmem media-az, lugol solution - az, may grenwalds stain - az, megnesium sulfate - az, merthyl orange indicator - az, methyl red indicator - az, methyl salycilate - az, mtt - az, n. butanol - az, naphthyl ethylinediamine dihydrochloride reagent - az, nessler.s reagent - az, phosphoric acid-az, pipette pump-az, pms.phenazine methosulfate-az., pnpp.para.nitrophenly phosphate disodium.-az, potassium dichromate-az, potassium dihydrogen phosphate-az, potassium hydrodide-az, pottasium dihydrogen phosphate.kh2po4.-az, pottasium hydrogen phosphate.k2hpo4-az., propionic acid-az, rbc diluting fluid-az, rpmi 1640 media-az, saline citrate-az, peptone-az, perchloric acid - az, petroleum ether - az, ph buffer capsules . 7.0 0.05. - az, food adulteration kit - az, glycerol - az, haematoxylin - az, hbss - az, hypochlorite - az, indigo carmine - az, isopropanol - az, leishman stain - az, sodium di.hydrogen phosphate-az, sodium hydroxide-az, sodium phosphate dibasic dihydrate-az, sodium potasssium tartarate-az, sodium succinate-az, stanous chloride-az, starch-az, sulphanilamide-az, sulpho salicylic acid-az, sulphuiric acid -az, thiurea-az, toluene -az, trichloro acitic acid.tca.-az, tris buffer-az, trisodium phosphate -az, wagners reagent-az, wbc diluting fluid-az, whatman filter paprer cat no.1001.125-az, whatman filter paprer cat no.1001.150-az, whatman filter paprer cat no.1001.185-az, benzene 1-az, ph buffer capsules .4.0 0.05.-az, ph buffer capsules .9.2 0.05.-az, phenol solution-az, phenopthalein indicator-az, phenyl alanine 4-az, potassium iodide 1-az, potassium permanganate 2-az, sodium azide 2-az, sodium chloride 2-az, sodium sulphate 3-az, sucrose 2-az,

CTN :39858766

18 Apr, 2025 NA

Mumbai - Maharashtra

Tender For supply of lanthanum chloride , ammonium sulphamate , iodine resublimed , potassium carbonate , napthanol ar , methanesulfonic acid s , phthalein purple , methylene blue , orthophosphoric acid , mercuric iodide red , tin chloride dihydrate , bovin albumin , formic acid , formaldehyde solution , methanol hplc , diethyl ether

Central Government/Public Sector

CTN :39446096

01 Apr, 2025 NA

Belgaum - Karnataka

Tender For corrigendum : supply of commercial ether - 1 diethyl ether commercial per liter , 2 diethyl ether commercial per liter , 3 diethyl ether commercial per liter , 4 diethyl ether commercial per liter , 5 diethyl ether commercial per liter

CTN :39697186

07 Apr, 2025 NA

Multi City - Telangana

Tender For corrigendum : supply of etp chemicals and consumables-, antiscalent chemical for ro membrance (water palnt), antiscaling chemical with ph booster for 5mt boiler dosing, ink cartridges, makeup cartridges, cleaning solution, etp chemicals, hydrochloric acid (hcl), sulphuric acid, lr grade, 05 ltrs pack, k2cr207potassium dichromate er 500 gr pack, ferroin indicator, 100 ml pack, mercuric sulphate,250 gr pack, silver sulphate, 25 gr, petroleum ether,2.5 ltrs , sodium azide 100 gr , manganous sulphate 500 gr , manganoussulphatemonohydratesq 500g, ferric chloride250 gr , calciumchloride250 gr , hcl250 ml , starch500 gr , ferrous sulphate500 gr , whatman filter paper 40 no - 01 no's, whatman filter paper, 41 no-01 no's, normal filter paper 1mx1m- 02 no's (10 sheets), sodium hydroxide pellets250 gr , sodium iodide100 gr , sodium thiosulphate500 gr , kh2p04 (potassium dihydrogen o phosphate) 250 gr, na2hp04sodium phosphate monobasic anhydrous er 250 gr, buffer solution ph 4.0 , buffer solution ph 7.0 550ml , buffer solution ph 9.2 550ml , ferric alum, pac, dap , hypochlorite , urea

CTN :39730459

04 Apr, 2025 NA

Jaipur - Rajasthan

Tender For corrigendum : supply of supply of ethernet siwtch as per soj-stc , supply of wan routers as per soj-stc , supply of licensed ecscada server software at jaipur, upgradation of existing scada license (perpet , upgradation of ecscada software at mundra abd ews locations, network confguration services of ether

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39320533

28 Mar, 2025 20.23 Lacs

Ranchi - Jharkhand

Tender For bid to ras supply of ether solvent , ketamine hcl 50 mg oblique ml 2 ml inj , thiopentone inj of 0point5 g without water for injection , bupivacaine hcl 5 mgobliqueml 20 ml inj , bupivacaine hcl 5 mgobliqueml heavy 4 ml inj , lignocaine hcl 2percent without adrenaline 30 ml inj suitable for ophthalmic use also , lignocaine hcl 2percen with adrenaline , lidocaine oblique lignocaine hcl 2percent with adrenaline , atropine sulphate 0point6 mg 1 ml inj , peracetic acid bott of 810 gm , diclofenac sodium suppository 100 mg , indicator soda lime , paracetamol with cysteine hcl monohydrate infusion 1000mgoblique100ml , common cold tab antihistiminics plus paracetamol 500 mg without pseudoephedrine , etoricoxib 120 mg tab , piroxicam 20 mg tab , fentanyl citrate 50mcgoblique ml 2 ml inj , fentanyl 50mcgoblique ml 10 ml inj , morphine 15 mg 1 ml inj , indomethacin 75 mg sr tab , indomethacin 25mg tab oblique cap , ketorolac 10 mg tab , tramadol hcl 50 mg cap oblique tab , betamethasone 4mg 1ml inj , adrenaline tartrate 1 isto 1000 coma 1 ml inj , levo des cetrizine 5mg tab , dexamethasone 0point5 mg tab , pheniramine maleate inj 22point75 mg per ml amp of 2 ml , methylprednisolone 16 mg tab , promethazine hcl 2point5 percent 25mgm oblique ml 2 ml inj , levetiracetam 100mg oblique ml vial of 5 ml inj , piracetam 400 mg tab , oxcarbazepine 150 mg tab , carbamazepine 200 mg tab , clonazepam 2 mg tab , lorazepam 2mg oblique ml 2 ml inj , diazepam 5 mg tab , lamotrigine 25 mg tab , lamotrigine 50 mg tab , sumatriptan 50 mg tab , topiramate 25 mg tab , rizatriptan 5 mg tab , baclofen 10 mg tab , acebrophylline 100 mg cap , budesunide 1 mg respules , carbimazole 20 mg tab , ethambutol 1200 mg tab , mycophenolate mofetil 250 mg tab , diethylcarbamazine 50mg tab , clofazimine 100mg cap , rifampicin 150mg cap , rifampicin 600 mg plus tab inh 300mg tab , ethambutol 200mg tab , isoniazid 300 mg tab , chloroquine phosphate 250mg tab , primaquine 7point 5mg base tab , silver sulphadiazine 1 percent ointment 20 gm tube , azathioprine 50mg tab , cyclosporine a micro emulsion 25 mg cap , hydroxyurea 500 mg cap , methotrexate 5 mg tab , inj goserelin 3point6 mg prefilled syringe zoladex 3point6 mg , letrozole 2point5 mg tab , levodopa 100 mg and carbidopa 25 mg tab , amantadine 100 mg cap , cabergoline 0point5 mg tab , rasagiline 1mg tab , trihexyphenidyl hcl 2 mg tab , tab levodopa 125 mg , tab levodopa cr 250 mg , tab topiramate 50mg , tab pregablin 75 mg , ferric hydroxide sucrose complex 20 mg in 5ml for injection , erythropoeitin human recombinant 2000 iu , tranexamic acid 500 mg oblique 5ml inj , phytomenadione vit k 1 mg oblique 0point5 ml inj , prasugrel 10 mg tab , fenofibrate 160 mg tab , carvedilol 3point125mg tab , diltiazem 60 mg tab , diltiazem controlled delivery 90mg tab , fenofibrate 200 mg tab , isosorbide dinitrate 10 mg tab , isosorbide mononitrate 20 mg tab , tab perindopril 8mg , esmolol 100 mg 10 ml inj , prasugrel hcl 5 mg tab , lignocaine hcl solution 2percent for iv use 50 ml inj , enalapril maleate 10 mg tab , enalapril maleate 2point5 mg tab , nebivoilol 5mg tab , labetalol hcl 100 mg tab , metoprolol 1 mg oblique ml 5 ml inj , nifedipine retard 20 mg cap oblique tab , propranolol tr 40 mg tab , ramipiril 2point5 mg tab , digoxin 0point25 mg tab

Central Government/Public Sector

CTN :39774589

12 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals and consumables - oxalic acid graterthan 99point5 percent cas 6153-56-6 , 2 4 dinitrophenol 99 percent cas 51-28-5 3x100gm , abts 2 2-azino-bis 3-ethylbenzothiazoline-6-sulfonic acid diammonium salt 30931-67-0 , acetylcholine chloride ar 1 pack of 10 g , ag agcl 3m kcl reference electrode basmf2056-1ea , ag 50w to x8 cat exch resin biotechnology grade 100 to200 mesh hydrogen form , al2o3 pl slurry 0.05meu 1pkt of 10g , al2o3 pl slurry 0.3meu 1pkt of 10g , al2o3 pl slurry 0.5meu 1pkt of 10g , aluminium foil 25micrometer 20 roll per piece 50m , ammonium fluoride ar acs assay 98 percent cas 12125- 01-8 1pack of 25 g , arsenic iii oxide ar assay 99 percent cas 1327-53-3 1pack of 500g , benzofuran for synthesis cas no 271896 b8002-25g , bis salicylaldehyde orthophenylene diamine reagent , bolds basal medium , boron trichloride 178934-100g , bromcresol green cas 76- 60-8 , bromcresol purple ar cas 115-40-2 , bromphenol blue ar cas 115-39-9 , cadmium nitrate tetrahydrate purified assay 99 percent cas 10022-68-1 1pack of 100 , cellulose acetate cas 9004-34-6 , cellulose powder, for column chromatography , centrifuge tube box polypropylene 15ml tarson polylab axiva , centrifuge tubes 50 ml 5 packets 200pc per pack , cetrimide agar , chitosan cas 9012-76-4 , cholchicine 64-86-8 , copper sulphate anhydrous cas no 12852-250g , cresol red ar, cas 1733- 12-6 , cuprous iodide 99 percent cas 7681-65-4 , curcumin grater than equal to 94 percent purity cas no 458-37-7 00280590-10 mg x2 00280590-10mg , curcuminoids 80 percent purity cas no 458-37-7 c7727-500mg , desicator vaccum polypropylene diameter 200mm tarson or polylab , dichloromethane 34856-1ltr , dimethylamine cas 124-40-3 , dmf cas no 68122 , dmso cas no 67-68-5 , dpph cas no 1898664 d9132-5gm , dulbecco phosphate buffered saline d5652-10x1l , eppenndorf-microcentrifuge tubes 1.5ltr , ethanol 99 percent , ethylenediaminetetraacetic acid disodium salt dihydrate , centrifuge tubes 15ml , folin and ciocalteu phenol reagent , formaldehyde cas no 50-00-0 252549-100ml , formic acid gr 98.0-100 percent cas no 64- 18-6 , furan for synthesis assay 99 percent cas 110-00-9 1 pack of 100ml , furfuraldehyde ar acs assay 99percent cas 98-01-1 1 pack of 500 , gallic acid 149-91-7 , glycerol 56-81-5 , graphite fine powder 98percent cas 16940-66-2 , high salt medium , hydrogen peroxide solution 30percent cas 7722-84-1 , icp multi-element standard solution iv sigma merck 23 elements in diluted nitric acid 1000 mg l ag, al, b, ba, bi, ca, cd, co, cr, cu, fe, ga, in, k, li, mg, mn, na, ni, pb, sr, tl, zn , immersion oil , in line syringe filter holder 25mm psf tarson or polylab or axiva , in line syringe filter holder 47mm psf tarson or polylab or axiva , iron oxide cas no 1309-37-1 , l-malic acid 99percent cas 97- 67-6 , lb broth , macconkey agar , mask , methyl diethanol amine cas 105-59-9 , methyl orange cas 547-58-0 3x100gm , methyl red cas 493-52-7 3x100gm , methyl yellow cas 60-11-7 3x100gm , mini spatula , n-methyl-2- pyrrolidone for hplc 99percent , naoh-solid cas no 1310732 6x1kg , neutral red ar cas 553-24-2 , nutrient agar , nutrient broth , p-nitrophenol ar cas 100-02-7 , parafromaldehyde cas 30525-89-4 , petroleum ether cas no 8032324 , phenol red sodium salt indicator cas 34487- 61-1 , phenolphthalein indicator cas 77-09-8 5 x100gm , phenyl boronic acid cas 98-80-6 1pack of 25g , pipette rack horizontal z shape polypropylene tarson or polylab oraxiva , pnpa-paranitrophenylacetate 2 bottle of 25g , polyvinylidene fluoride cas 24937-79-9 , polypropylene beaker garduated 500mltarson or polylab or axiva , polypropylene forcep , polypropylene measuring cylinder graduated class a 500ml tarson or polylab , potassium hydroxide 90 percent flakes 484016-1kg , potassium permanganate 238511-100gm , potassium persulphate 7727-21-1 , potassium sulphate cas no 7778805 223492- 500gm , potato dextrose agar , potato dextrose broth , ptfe stirrer 10 x 250mm , pyrrole for synthesis assay 97.