Latest liquor amonia Tenders | Government liquor amonia Tenders

Central Government And Public Sector

CTN :38680740

31 Mar, 2025 NA

Pondicherry - Pondicherry

Tender For bid to ras supply of consumables - qubit tm 1x ds dna hs assay kit ,100 assay , qubit tm assay tubes, set of 500 , qubit tm rna hs assay kit, 100 assay , qubit tm rna br assay kit ,100 assay , ampure xp reagent,5 ml , water, sterile, molecular biology grade depc treated, nuclease and protease free ,100ml , premium grade ethanol 100 percentage,500 ml , q5 pcr master mix 2x high fidelity new england biolabs,500 reactions , promega gel loading dye 6x , 100bp ladder dx per dt loaded with green dye ,500 ul,50 ug , invitrogen ladder 1kb plus dna ladder, 1 ml 10x loading buffer ,500 ul , hi-syrr safe gel stain ,10,000x in dmso , agarose ,500 g , tae 50x ,1l , preperation rack, 96 well, with cover , 50 well microtube storage box, for 1.5 to 2.0 ml tubes , dneasy blood and tissue kit ,250 rxn , kimberly clark kimwipes, 14.7 in 16.6 in, 140 count , m 4 inch parafilm tape, color white , autoclave indicator tape , ethanol, absolute ,200 proof, molecular biology grade, fisher bioreagents , rsa i restriction enzyme ,neb , neb blunt per ta ligase master mix,250 rxn , neb next ffpe repair mix,96 rxn , neb next ultra ii end repair or da-tailing module,96 rxnx , neb next quick ligation module , 12 tube magnetic seperation rack , flow cell priming kit , native barcoding kit ,24 barcodes , flowcell wash kit , flongle flow cell ,pk 1 , luria bertami agar, miller luria bertani agar , luria bertani broth, miller , l spreader , sterile disposable petriplates , ampicillin sodium salt ,amp,na,5g , kanamycin monosulphate ,km, extrapure, 750mcg per mg,5g , his,tagged bacterial protein ,gravity flow , carbenicillin disodium salt, 90 percentage ,5g , isopropyl b d thiogalactopyransoside ,iptg, dioxan free for mb, 99 percent 25 g bid number/ ( ( ) ) : gem/2024/b/5741465 dated/ * : 23-12-2024 bid document/ 2 2 1 / 36

CTN :39844118

10 Apr, 2025 1.24 Lacs

Haveri - Karnataka

Tender For supply of lab consumables and chemicals and various items to hims haveri - novachrom cold. afb .staining kit., gram.s stain. kit.1 kt, glass vails with rubber cap 30 ml., blotting .paper., escherichia coli atcc 25922., staphylococcus aureus .atcc 25923., tissue. roll., tripple layer. mask., hand gloves.., absorbant cotton .., sodium. hypochlorite., spirit.., urine collection containers., sterile swab sticks with stick., tube cleaning brush., lab clean., phenol.., micro. slides., concave slides., inoculation loop .4mm with handle., inoculation loop .2mm with handle., urea agar .base., triple sugar .iron agar., mannitol motility. test medium., peptone water., mac.conkeys agar. , culture plates .disposable., ziehl.nielsen stain., xylene., test tubes .18x150mm., test tube. holders., sulphur .500g., sulphosalycilic .acid. , spirit surgical 4.5l., sodium nitroprusside .100g., sodium .hypo .chloride ., sodium hydroxide .500g., sodium chloride .500gm., plastic tray .small., plastic tray big., paraffin wax 1kg., normal saline 500ml., nitric acid 2.5l., methanol acetone. free .2.5l, litmus paper red packet., leishman.s stain. with buffer. 500ml, hydrogen peroxide .500ml., hydrochloric .acid 2.5l., hematoxylin and .eosin., glass slides .pack of 50., funnels .plastic., fouchet.s reagent. 125ml, formalin 37 to 41., filter .paper., ferric .chloride .500g., ethanol 500ml., esbach.s reagent. (500ml)., dropper .3ml., dropper .1ml., dpx .500ml., distilled .water 5l., dextrose .500g., cover slips 22x50mm .10gm., cover slips 22x22mm 10gm., cotton rolls .500g., cedar wood oil .used on glass slides 25ml., benedicts .reagent. 5l., basin. steel., barium chloride .500g., antiserum.blood grouping 10ml., ammonium. oxalate .500gm, ammonia .500ml., acetone. 500ml., box canting 25 pieces., one box .100 pieces., pantoprazole .domperidone .strip of 10., ibuprofen paracetamol strip of 10, ciprofloxacin .tinidazole .strip of 10., antacid .gel . mg ., cotrimoxazole .strip of 10. , carbidopa levodopa tablets .strip of 15. , povidone iodine .solution .100ml bottle , calamine lotion 177 ml .bottle., neomycin sulphate, polymyxin b, bacitracin zinc ointment .10 g tube, oral rehydration salts powder 21.8 g sachet, dextran 40 .500 ml., ringer lactate .500 ml., dextrose 500 nil., iv fluids normal saline 500 nil., liquid .paraffin emulsion 100 ml bottle., cefixirne dry syrup reconstituted suspension .30 ml bottle., saline nasal drops solution 10 ml bottle, adrenaline tartrate injection 1 ml ampoules, neomycin sulphate polymyxin b bacitracin zinc powder 10 g bottle, amoxicillin .capsules strip of 15., isosorbide dinitrate sublingual tablets .strip of 10., clotrimazote vaginal pessaries mucoadhesive .extended nrelease tablets packet of 6., nicotine or glyceryl trinitrate transderrnal .patches. , oxymetazoline. hydrochlorid nasal spray 10 ml bottle, aspirin . dispersible .tablets strip of 10, insulin pens box of 1., rotahaler device packet .of 1, spacer device box of 1., metered dose inhalers .salbutamol , tissue .roll., plain slides each .box containing 100 slides., slide cover slips each. box containing 100 pieces., disposable mask each .box containing 50 pieces., m size hand gloves. each box containing .100 pieces., spirit. liters 5 l., cotton big roll, thin rubber. sheet in mtrs 2mm., reusable. plastic aprons. , formalin 20 ltrs can , ziehl. nielsen .stain., spirit .surgical. , sodium .nitroprusside. , sodium .hypo chloride. , sodium .hydroxide. , sodium .chloride. , plastic tray. small., plastic .tray .big., paraffin .wax. , normal .saline., glass .slides. , distilled .water., dextrose.., cover. slips 22x50mm. , cover slips 22x22mm. , cotton. rolls, capillary tubes for clotting time estimation., dropper 3ml., glass slides 75mm x 25mm,thickness1.1mm., disposable mouth piece for. spirometry., ecg.. gel., ecg thermal paper roll 80mmx20mtr., antisera for blood grouping.., ethanol 500ml., cedar wood oil 25ml., surgical blade no. 15. , slide .staining rack with bunsen burne

CTN :39846918

17 Apr, 2025 14.57 Lacs

Belgaum - Karnataka

Tender For supply of drug and medicine - adapalene 0 point 1 percent tube of 15 gm , tacrolimus oint 0 point 03 percent 20 gm tube , benzoyl peroxide 2 point 5 percent tube of 20 gm tube , calamine lotion 50 ml tube , betamethasone dipropionate 0 point 05mg gentamycin sulphate 1mg tube of 5gm , zinc oxide titanium dioxide bott 50 sunscreen lotion bottle of 60 ml , clindamycin phosphate 1 percent topical gel tube of 10 gm , clobetasol propionate cream 0 point 05 percent in tube of 10 gm , desonide 0 point 05 percent bott of 30 ml , fluticasone 0 point 05 percent w per w cream 10gm tube , liquor formaldehyde 40 percent w v , framycetin sulphate cream bp 1 percent cream 20 gms , ketoconazole lotion 2 percent bott of 75ml , isotretinoin 20 mg cap , metronidazole 1 percent tube of 30gm , permethrin 5 percent tube of 30 gm , lotion terbinafine 1 percent 20 ml , terbinafine 1 percent cream tube of 10 gm , tretinoin 0 point 05 percent tube of 20 gm , hydroxyzine hcl 25mgtab , fusidic acid cream 2 percent w per w 10g tube , paradhichlorobenzene 2 percent benzocaine percent chorbutol 5 percent turpentine oil 15 percent ear drop clear wax , sodium hypochlorite 5 percent , 10 percent povidone iodine solution 1 percent iodine 500 ml bott , chloroxylenol hydroxide 13 point 6g chloroxylenol solution 50 point 5g oleic acid 7 point 5ml castor oil 63 point 0g terpineal 100ml ethanol 96 percent 200ml , chlorhexidine chlorhexidine gluconate7point 5 percent cetrimide bp 15 percent 500 ml bott , povidone iodine solution 5 percent bottle of 100 ml , acetazolamide 0 pouint 25g tab , tab dutasteride 0 point5 mg , cilnidipine 5 mg tab , frusemide 40 mg tab , frusemide 20 mg 2 ml inj , eplerenone 25 mg tab , spironolactone 50 mg tab , rifaximin 550mg cap ,frusemide 40 mg amiloride hydrochloride 5 mg tab , pancreatic enzyme supplement lipase content of 25000 units cap , antispasmodic containing mefenamic acid 250 mg dicyclomine hcl 10 mg , tab levosulpiride 25 mg , tab entacavir 0 point 5 mg , antacid chewable aioh 3 300mg mg silicate 25 mg simethicone 25 mg , trypsin and chymotrypsin 6 ratio 1 100000 au enteric coated tab , ranitidine hcl 50 mg 2 ml inj , metoclopramide 10 mg tab , metoclopramide hcl 5mg ml 2ml inj , dicyclomine 20 mg paracetamol 500 mg tab , dicyclomine hcl 20mg inj , drotaverine hcl 20 mg per ml inj , hyoscine bromide inj 20 mg per ml 1ml inj , mebeverine hcl 135mg tab , isapgol ispaghula husk 3 point 5 gm , bisacodyl 5 mg tab , parraffin liq in bottle of 100 ml , pancreatic enzyme cap lipase content of 10000 to 20000 units , loperamide 2mg tab , pantoprazole 40 mg domperidone sr 30 mg cap , pantoprazole 40 mg levosulpride 75 mg cap , rifaximine 400 mg tab , ethinyl estradiol 0 point 035mg cyproterone acetate 2mg pack of 21 tablets , oestrogen cream concentration 0 point 06 percent to 0 point 1 percent tube of 15 to 50 gms , clotrimazole vaginal pessary 100mg , levonorgestrel 0 point 25 mg ethinylestradiol 0 point 03mg pack of 21 tab , nor ethisterone 5mg tab , gliclazide mr 30 mg tab , glipizide 5mg tab , glibenclamide 5mg tab , sitagliptin 50 mg metformin 1000mg tab , linagliptin 2 point 5 mg metformin 500 mg , pioglitazone hydrochloride 15 mg tab , carbimazole 5 mg tab , alendronate sodium 70mg tab , pyridostigmine 60 mg tab , calcium acetate 500 mg tab , protein supplement for predialysis renal failure , sevelamer 400 mg tab , betaxolol eye drops 0 point 25 percent 0 point 5 percent bott of 5 ml , chloramphenicol 0 point 5 percent dexamethasone sodium 0 point 1 percent bott of 5 ml , ciprofloxacin hcl 0 point 3 percent dexamethasone 0 point 1 percent bott of 5ml , gatifloxacin 0 point 3 percent eye drop bott of 5 ml , gentamicin sulphate 0 point 3 percent gentamicin base with hydrocortisone acetate ip 1 percent eye ear drops bott of 5 ml , ketorolac tromethamine 0 point 4 percent eye drops , brimonidine tartrate 0 point 2 percent eye drops , methyl cellullose 2 percent solution bottle of 5 ml , ofloxacin 0 point 3 percent bott of 5 ml , luli

CTN :39847014

17 Apr, 2025 NA

Kheda - Gujarat

Tender For supply of manpower supply in various categoriesincl of overtime - highly skilled manpower- planning and office assistant , skilled manpower- 2 electrician, plt sampling and ethanol unloading , semi skilled manpower- plt monitoring at omc side, gantry ops and monitoring, safety checks ,vts and planning , overtime charges - variable- highly skilled , overtime charges - variable skilled , overtime charges - variable -semi- skilled , ppe charges

Central Government / Public Sector

CTN :39857687

11 Apr, 2025 96.26 Lacs

Chennai - Tamil Nadu

Tender For supply of ion chromatography system for testing of inorganic chloride and inorganic sulphate in ethanol 100 , gas chromatograph for testing of ethanol, methanol and higher saturated alcohol content in ethanol

Central Government/Public Sector

CTN :39858892

07 Apr, 2025 NA

Tiruchirappalli - Tamil Nadu

Tender For supply of gastec gas detector tube acetone code 151l , gastec gas detector tube carbon dioxide code 2lc , gastec gas detector tube ethanol code 112l , gastec gas detector tube hydrogen fluride code 17 , gastec gas detector tube hydrogen chloride code 14m , gastec gas detector tube isopropyl alcohol code 113l , gastec gas detector tube nitrogen dioxide code 9l , gastec gas detector tube oxygen code 31b , gastec gas detector tube sulphuric acid code 35 , gastec gas detector tube trichlorethylene code 132l , gastec gas detector tube toulene code 122l , gastec gas detector tube xylene code 123

Co-operative

CTN :39810550

01 Apr, 2025 90.00 Lacs

Jaipur - Rajasthan

Tender For e-tender document for supply of lab chemicals and glass ware / potassium permaganate/surgical gloves / iso amyl alcohal - potassium permagnate crystal (commercial grade), tsp (tri sodium phosphate) commercial grade, salt a (per 500 ml pack), absolute ethanol (per 500 ml pack), sulphuric acid lab grade ( 5 lit. plastic jar pack), iso amyl alcohol lab grade (500ml pack) (melting point:- 117.2 degree c) (boiling point:- 131 degree c ) density:- 0.810 kg/1,) (solubility:- water 25 g/1 at 20 degree c) refractive index:- 20/d 1.4053 physical description :- liquid, qualigens, e-merck, cdh, qualikems, rankem, lab chemicals & glassware, ranbaxy, sd fine, glaxo / qualigens universal, e-merck, loba, himedia, borosil, duran (germany) / ravira, qualikems, supertek, satol, polylab, religlass, cdh, whatman, diversey, dorson, moxcare, abdos, butyrometer ( benny make), for cream, for butter, for milk, for cheese, surgical gloves sterlized size 7.5" & 8", surgical gloves non-sterlized size 7.5" & 8", nitrile gloves(food grade), halyard, moxcare, labserv, kimberly-clark, cotton absorbent 500 gm / 400 gm pack, cotton non-absorbent 500 gm / 400 gm pack, disposable cap, disposable face mask, thermometer 0-110 deg.c (dimple make), type:alcohol, type:mercury, lactometer-(20 to 40 range) 15.5 c, jupitor, benny, jk, lactometer supreme quality dual tested range:0-40@84 deg f,accuracy: 0.0002, division:0.001 (jk make), lock stopper (make benny), rubber cork no.1 for test tube, edta commercial grade, pipette 10.75 ml super delux benny make, water bath- ordinary, water bath- serological, water bath- with thermostatically, hot air oven (s.s.), hot plates round, 8 inch, 12 inch, b.h.a. food grade, digital thermometer- 10 deg.c to 250 deg.c, b.r. meter, distilled water, filter paper grade 4, size:125 mm, dorson, whatman, filter paper grade 41, size:125 mm, dorson, whatman

State Government

CTN :39826251

10 Apr, 2025 50.00 Lacs

Kotdwar - Uttarakhand

Tender For lab reagents supply work at govt base hospital kotdwara - items articals for lab, binocular microscope with lens, electrolyte (na+,k+,ca+) pack, esr disposable westergren tube, esr stand wintrobe, esr stand westergren, spirit lamp, test tube rack (aluminium), slide box, hot air oven, incubator, stethoscope, blood pressure machine, physical balance &weight box, rh viewing box(electrical), photocaloriemeter, oil immersion lens 100x, stopwatch, timer, vdrl shaker with timer, semi auto analyser, antisera abd, acetone, acetic acid glacial, ammonia solution, ammonium sulphate powder, ammonium oxalate powder, auto pipette 5-50ul, benedicts solutionqualitative, benedicts solution quantitative, brush test tube, barium chloride 10%, conc . hcl, conc. h2so4, conc hno3, carbol fuchsin, test tube rack aluminium, high power lens 40x, low power lens, auto pipette 50-200ul, auto pipette 1000ul`, auto pipette 500ul, auto pipette 10ul, dropping bottle plastic 1000ml, neubaver counting chamber, disodium hydrogen phosphate, dropping bottle plastic125 ml, distilled water, eosin powder, edta powder, ethenol, eherlichs reagent, aec diluting fluid, edta vial, esr filling needle, fouchets reagent, filter paper, beaker plastic 100-1000ml, beaker glass 100-1000ml, centriguge tubes, glass test tube 12*75, glass test tube 12*100, glass cover slip, glass slide, glass capillary tube, glass haemoglobinometer, hb measuring tube 2-20%, glass pipette for hb 20ul, glass rbc pipette, glass wbc pipette, glass funnel, glass marking funnel, grams iodine, hydrogen peroxide, washing solution, pm kit (semi auto), am kit ( semi auto), glass cover slip, vacutainer vial red top, vacutainer vial, vaccutainer needles, aliquet 2ml, fluoride vials, sodium citrate vials, glass wbc pipette, glass funnel, dengue ns1ag/igm/igg card test, leishman stain, liquid paraffin, litmus paper red, litmus paper blue, methylene blue, multisticks for urine exam, malaria antigen card test, mountex ppd vial, n/10 hcl, pregnancy card test, typhoid dotigm/igg, vdrl card test, hbsag card test, hcv tridot, hiv tridot, urinometer glass, wintrobe esr tube, westergren esr tube, platelet diluting fluid, potassium oxalate, potassium dichromate, plastic washing bottle 250 ml, plastic stand, plastic funnel, pasteur pipette, potassium permagnate, printer roll/ paper, plane vial, edta vial, rubber bulb, rbc fluid, wbc fluid, sodium sulphate powder, sulphur powder, tips auto pipette white, tips auto pipette yellow, tips auto pipette yellow, semen diluting fluid, sodium hypochloride solution, tourniquette strong, tissue paper, uristicks for albumin sugar, urine collection pot disposable, wintrobe tube filler, xylene, liquor ammonia, acetone, aso latex slide test, raf latex slide test, crp latex slide test, rapid pap stain, diamond glass marker, gram stain, fnac plunger, ethanol, coverslip for fnac, mgg stain, gills haematoxylin stain, og / ea stain, 1% glacial acetic acid, wbc count fluid/ turk fluid, giemsa stain, spirit lamp, occult blood card test, water bath, thermameter

CTN :39834975

16 Apr, 2025 NA

Nadia - West Bengal

Tender For supply of laboratory material - aluminium foil , butter paper , surgical blade , bloting paper , bio hazared bag 550014 - 14x19 , ice bucket , beaker 1000d12 , beraker 1000d16 , beaker 1000d21 , beaker 1000d24 , beaker 1000d30 , cover slip 18mm , conical flask 250ml , conical flask 100ml , conical flask 500ml , measuring cylender , extran ma02 , hand wash , whatman filter paper no-1 90mm , forceps no 5-pointed watch maker , forceps blunt , glass slide , screw cap bottle , nitrile gloves medium , nitrile gloves large , nitrile gloves small , petridish 100x20 , glass funnel 35mm , glass funnel 65mm , glas funnel 100mm , paraflim , test tube rack 15ml , test tube rack 50ml , test tube 10ml , test tube 20ml , glass spreder , spatula ss , non absrobent cotton , ethanol , p.h indicator paper , squeeze bottle 500ml

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Liquor Amonia Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government And Public Sector

Central Government / Public Sector

Central Government/Public Sector

Co-operative

State Government

Central Government/Public Sector