Latest liquor amonia Tenders | Government liquor amonia Tenders

Central Government/Public Sector

CTN :39562351

07 Apr, 2025 NA

Roorkee - Uttarakhand

Tender For corrigendum : supply of various chemicals-, mercuric sphate , silver sulphate (ag/504) (258) , ammonium chloride (nh) (500g) , magnesium sulfate (mgso) (500g) , calcium chloride (cac) (500g) , nesslers reagent (100m) , potassium persulfate (,50%) (500g) , ammonium molybdate (100g) , stannus chloride (snc12) (100g) , glycerol (500m , calcium carbonate (caco) (500g) , cobalt chloride cocl2 (100g) , zinc chloride zn2(500) , nickel chiaride nic12 (500g) , manganese sulphate ms04 (500g) , sodium selenite na2seo3-5h20(25) , sodium tungstate dihydrate na2wo4-2h20(100g) , sulfanlic acid (5g) , n-(2-naphthyl)-ethylenediamine dihydrochloride (ned) (5) , hydrochloric acid (500 ml) , nitric acid (500 ml) , sulphuric acid (2.5l) , anthrone (100 , standard glucose (500g) , copper sulphate tetrahydrate (500g) , potassium hydrogen tartarate (500g) , na (500g) , cod call test (range 100-1500mg/(25/pack) , reagent bottle screw cap 500ml , hplc vail 2 ml transparent (paket of 1001 , hplc vail 2 ml amber colour (pallet of 1001 , silica crucilbel (25 ml) , beaker (100m) , reagent bottle (100 ml) , chemical weighing bottle (25-50 ml) , quartz cuvette , carboy (101) , glass slides (pack of 50) , cover slips (pack of 100) , membrane filter nylon (0.45m) (pack of 1001 , silicone rubber septum seals gl 45 (pack of 100),

State Government

CTN :39834913

07 Apr, 2025 NA

Gurgaon - Haryana

Tender For supply of acetonitrile lcms grade , psa spe suitable , c18 spe suitable , magnesium sulfate anhydrous acs , phosphate buffer saline , sodium acetate anhydrous acs grade

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

State Government

CTN :39796680

26 Mar, 2025 NA

Burdwan - West Bengal

Tender For supply of gram stains kit , hiper sds-page teaching kit , acrylamide , sodium succinate , isoamyl alchohol , hiper plasmid dna cloning teaching kit , bacteriological agar , p-dimethy amino benzaldehyde , congo red , aniline blue , tricalcium phosphate , manganese sulfate , soil testing kit , sodium bicarbonate , potasium ferricynide , calcium carbonate , ethyl acetate , naoh powder , cupric sulfate , ammonium per sulfate , hiper pcr teaching kit , potassium dichromate , hiper antigen capture elisa teaching kit , agarose, ultrapure, low eeo , lamda dna , diluent for dna extraction , acetone dried , copper (ii) acetate monohydrate, hi-ar /acs , syringe filter 0.22 m diameter (pore size) , acetonitrile hplc grade , ortho phosphoric acid hplc grade , gram stains kit , hiper sds-page teaching kit , acrylamide , sodium succinate , isoamyl alchohol , hiper plasmid dna cloning teaching kit , bacteriological agar , p-dimethy amino benzaldehyde , congo red , aniline blue , tricalcium phosphate , manganese sulfate , soil testing kit , sodium bicarbonate , potasium ferricynide , calcium carbonate , ethyl acetate , naoh powder , cupric sulfate , ammonium per sulfate , hiper pcr teaching kit , potassium dichromate , hiper antigen capture elisa teaching kit , agarose, ultrapure, low eeo , lamda dna , diluent for dna extraction , acetone dried , copper (ii) acetate monohydrate, hi-ar /acs , syringe filter 0.22 m diameter (pore size) , acetonitrile hplc grade , ortho phosphoric acid hplc grade

CTN :39792871

27 Mar, 2025 NA

Ezhimala - Kerala

Tender For procurement of expendable medical stores for echs polyclinics irt and kgd for qe jun 25 and sep 25 - betamethasone 0.1% + neomycin 0.5% oint, cabergoline 0.5 mg tab, cefaclor 250 mg tab, diclofenac + paracetamol + serratiopeptidase tab, empagliflozin (5mg) + metformin (500mg) tab, esomeprazole 40 mg + clarithromycin 500 mg + amoxicillin 750 mg (sompraz) cap, ondansetron 8 mg tab, pantoprazole 20 mg tab, rabeprazole 20mg +domeperidon 10mg tab, repaglinide 1mg tab, rifaximine 550 mg tab, rivaroxaban 2.5 mg tab, rivastigmine 3 mg tab, sildenafil 25 mg tab, silicon catheter 12 size, sterile gauze 10 cm x 10 cm 8 ply, syp ambroxyl (20mg/ 5ml) + dextromethorphan hydrobromide (10 mg/ 5ml) 100 ml, tab obeticholic acid 5 mg, tab rifaximine 200 mg, acetaminophen 325 mg + tramadol 37.5 mg (ultracet) tab, asthalin respules / levolin resp, coal tar + salicyclic acid lotion, disodium hydrogen citrate syrup 100 ml, duloxetine 10 tab, everolimus 0.5 mg tab, glimepiride 2 mg + metformin 500 mg sustained release tab, glimipride 2 mg + metformin sr 500 mg + voglibose, glipizide 5mg +metformin 500 mg tab, armodafinil 50 mg tab, calcium carbonate + calcitriol + methylcobalamine + vit k2 + zinc tab, glucosamine 500 mg +chondriotin 400 mg tab, methylcobalamine 500mg tab, pancreatin 10000 iu tab, nifedipine retard 10 mg tab, pioglitazone 30mg tab, aceclofenac 100 + serratio 15mg + pcm325mg tab, diclofenac 100 mg + metaxalone 400 mg tab, glibenclamide (2.5mg) tab, respule levosalbutamol 0.31 mg, risperidone 0.5 mg tab, rosuvastatin 10mg + aspirin 75mg tab, sodium valproate + valproic acid 200 mg tab, syp chlorpheniramine maleate 1 mg + paracetamol 125mg + phenylephrine 2.5mg of 60 ml bottle, tab sodium valproate 500 mg cr [sodium valproate(333mg)+valproic acid(145mg)], telmisartan 40 mg +chlorthalidone 12.5 mg tab, collagen peptide type 1, sodium hyaluronate, chondroitin sulfate & vit c tab (tendocare), thyroxine 37.5 mcg tab, torsemide 5 mg tab, carvedilol 12.5 mg tab, povidone iodine 10 % 15 gm oint, rivastigmine 1.5mg cap, salmeterol (50mcg) + fluticasone propionate (250mcg) [seretide accuhaler 50/250], tab metoclopramide 10 mg, tab pregablin 50 mg, miaps i2 crp kit of 30 test (agappe), lumber belt small, povidone iodine sol 10% bottle of 100 ml, timolol maleate 0.5% preservative free with comod system, carbidopa 18.75+levodopa 75 mg + entacapone 200 mg tab, canagliflozin 100 mg tab, quetiapine sr 100 mg tab

CTN :39796668

25 Mar, 2025 NA

Nadia - West Bengal

Tender For supply of sulfuric acid 98% (2.5 l) , sodium hydroxide (500 g) , acet ic acid glacial 100 % (500 ml) , ascorbic acid (100 g) , hydroge n peroxide (500 ml) , potassium dichromate (500 g) , diphenylamine for synthesis (100 g) , ortho-phosphoric acid 88% (500 ml) , ammonium iron (ii) sulfate hexahydrate (500 g) , charcoal act ivated (500 g) , boric acid powder (500 g) , pot assium permanganate (500 g) , perchloric acid about 70% (500 ml) , diethylenetriaminepentacet icacid (dtpa) (250 g) , ammonium acetate (500 g) , nitric acid about 69% (500 ml) , hydrochloric acid about 37% (500 m l) , ammonium fluoride purified (500 g) , triethanolamine (500 ml) , calcium chloride dihydrate (500 g) , potassium antimony (ii i) oxide tart rate hemihydrate (250 g) , methyl red indicator (25 g) , 2-4 dinitrophenol hyd razine 97 % , ammonium chloride (500 g) , salicylic acid (500 g) , disodium-edta (500 g) , azomethine-h (1 g) , kh,po. (potassium dihydrogen phosphate) (500 g) , nh. -oxalate (ammonium oxalate) (500 g) , nh.oh (ammonium hydroxide) (500 ml) , oxalic acid (500 g) , concentrated hf (hydrofluoric acid) (500 ml) , azocarmine (25 g) , ethyl alcohol (500 ml) , magnesium oxide (500 g) , k,so. (potassium sulphate) (500 g) , cuso. (copper sulphate) (500 g) , ammonium metavanadate (100 g) , 2,6-dichloro phenol indophenol (5 g) , sodium hydroxide (500 g) , ferrous ammonium sulphate (500 g) , sodium acetate (250 g) , tris acetate buffer (100 g) , potassium iodide (250 gm)

CTN :39222391

28 Mar, 2025 NA

Pune - Maharashtra

Tender For bid to ras supply of chemicals for preparaion of green primary explosives - 5 aminotetrazole monohydrate purity greater than 98 percent pack of 100 g as per qap no hemrl meg gpe rm 001 , copper ii sulfate pentahydrate purity greater than 98 percent pack of 500 g as per qap no hemrl meg gpe rm 002 , sulfuric acid purity greater than pack of 2 point 5 lit as per qap no hemrl meg gpe rm 004 , celite 545 purified calcined , ph equal to tilde 8 pack of 1 kg as per qap no hemrl meg gpe rm 005 , copper i chloride reagent plus purified purity greater than 99 percent pack of 100 g as per qap no hemrl meg gpe rm 006 , 3 bromoanisole purity greater than 99 percent pack of 500 g as per qap no hemrl meg gpe rm 007 , aminoguanidinium bvicarbonate purity greater than 98 percent pack of 500 g as per qap no hemrl meg gpe rm 008 , ammonium acetate acs reagent purity greater than 97 percent pack of 500 g as per qap no hemrl meg gpe rm 009 , silver nitrate acs reagent purity greater than 99 percent pack of 100 g as per qap no hemrl meg gpe rm 010 , ammonium iron iii sulfate dodecahydrate acs reagent purity greater than 99 percent pack of 500 g as per qap no hemrl meg gpe rm 011 , ammonium thiocyanate acs reagent purity greater than 97 point 5 percent pack of 500 g as per qap no hemrl meg gpe rm 012 , 1 butanol acs reagent purity greater than 99 percent pack of 500 ml as pe qap no hemrl meg gpe rm 013 , glacial acetic acid acs reagent purity greater than 99 percent pack of 2 point 5 lit as per qap no hemrl meg gpe rm 014 , potassium dichromate acs reagent purity greater than 99 percent pack of 500 g as per qap no hemrl meg gpe rm 015 , sodium hydroxide purity greater than 98 percent pack of 500 g as per qap no hemrl qap naoh 2024 317 , acetone purity greater than 99 point 5 percent pack of 2 point 5 lit as per qap no hemrl qap rm acetone 2023 52 , isopropyl alcohol purity greater than 99 percent pack of 2 point 5 lit as per qap no hemrl qap rm ipa 2023 43 , potassium hydroxide purity greater than 85 percent pack of 500 g as per qap no hemrl qap koh 2024 319 , sodium azide purity greater than 99 percent pack of 500 g as per qap no hemrl qap sodium azide 2024 360 , nitric acid purity greater than 70 percent pack of 2 point 5 lit as per qap no hemrl qap rm nitric acid 2023 54 , sodium nitrite purity greater than 96 percent pack of 500 g as per qap no hemrl meg gpe rm 003

Central Government And Public Sector

CTN :39711374

15 Apr, 2025 4.97 Crore

Belgaum - Karnataka

Tender For tender for rate contract supply of drugs items to bims belagavi - zince oxide 20gm cream, zinc syrup 60 ml , xylometazoline 0.1% nasal drops 10ml, white petrolium 100% pure jelly 500gm, white petrolium 100% pure jelly 30gm, wax solvent ear-drops 10ml benzocaine 2.7%w/v+chlorbutol5%w/v+paradichlorobenzene2%w/v+turpentine oil-15%w/v, vitamin-e drops 50mg/1ml-15 ml, vitamin-d3 60000 iusachet, vitamin d3 400-iu 15ml (drops), vitamin b complex 200ml (syrup), vitamin a syrup (60 ml), vitamin a solution (100ml), ultra sound gel (5kg), turpentine oil (100ml), tropicamide- 5ml eye drops , triple combination cream (momethasone 0.25% with tretin 0.1% with hydroquinone 2.0%) 15 gm, triamcinolone 0.1% w/v 5gm oral ointment, tretinoin 0.025% cream , topical5% emla cream 15gm, topical lignocaine 25mg/g, prilocaine 25mg/g cream-5%- 5 gm (cream), tobramycine 0.3%10ml (eye drops), tincture benzoine (100ml), timolol maleate 10ml eye drops, thrombophobe ointment (20gm), theophylline with etophylline (200ml syrup), sucralphate (170ml syrup), soft roll (15cm x3mtr), soft roll (10cm x3mtr), sodium valproate 200mg/100ml (syrup), sodium phosphate enema (100 ml), sodium hypochloride 5-6% solution 5ltr, sodium hypochloride 5-6% solution 20litr, sodium chloride (nasal drops), sodium by carbonet ip 600gms with sodium-chloride ip 230gms t packets 1x830, silymarin l-ornithine l-asparatate (200 ml syp), silver sulphadiazine -15gm cream, silver sulphadiazine -100gm cream, sildenafil oral suspension 10 mg/ml, salbutamol-nebulisation repsules 2.5mg 2.5ml (amp), salbutamol- nebuliser solution (salbutamol 100microgram/actuation pressurised inhalation 200 actuations(pi,cmi)-15ml., salbutamol 2mg (100ml syrup), prednisolone acetate 1% + hpmc 0.25%-5 ml eye drop , povidone iodine solution in dark plastic bottle 500ml 5% w/v (500ml), povidone iodine ointment 5%w/v (15gm), povidone iodine ointment 5%w/v (125gm), povidone iodine cleansingsolution in dark plastic bottle 7.5 %w/v (500ml), potassium chloride (200ml syrup), pop roll 2.7 mtr x 15 cm (1roll), pop roll 2.7 mtr x 10 cm (1roll), phenytoin sodium 125mg (100ml syp), phenobarbiton 20 mg/5 ml-(100ml syp), permethrin 5% 30gm ointment, paracetamol 125mg/100ml (syrup), ors (who formula) 21gm, orodispersible probiotic sachets 2 gm-10 (sachets.), ondansetron 4mg/5ml 30ml (syrup), nuprep gel (114 gm), normal saline nasal 10ml drops, neomycin sulphate, polymyxin b sulfate and hydrocortisone 5 ml ear drop-, natamycin 5ml eye drops, mupirocin 2% 5gm ointment, multi vitamin with zinc 200ml (syrup), multi vitamin (zinc+b12+b-comp) drop-30ml, moxifloxacin 0.5%5ml eye drops, moxifloxacin 0.5% 5gm eye ointment , mometasone 1% 15gm (cream), micropore plaster size1.25cm x 9.1mtr 0.5 inch1roll (tissue plaster), micropore plaster size 7.5 cm x 9.1mtr 3inch 1roll(tissue plaster), micropore plaster size 2.5 cm x 9.1 mtr 1inch 1roll (tissue plaster), metronidazole 1.5% w/w -20gm gel, mefenamic acid with paracetamol 50+125mg/5ml 60ml (syp), mct oil 100ml (medium chain triglyceride (mct oil (100ml), luliconazole cream 1%w/v (10gm), liquid paraffin (60ml), lignocaine gel 2% (30gm), lignocaine 10% 50ml (spray), levetiracetam 100mg/ml (syrup), lactulose (200ml syrup), ketokonozol 2%with zinc payrithione 1% (100ml), ketoconazole 2% 20gm (cream), iron and folic acid-30 ml (drops), iron and folic acid (200ml syrup), ipratropium(500.0 mcg) + levosalbutamol / levalbuterol(1.25 mg) 3 ml (respules), hydrogen peroxide solution (100ml) amber bottle wrapped with black thick polybag with printed label 6% w/v, hmf sachet 2gm ( (lactodex hmf nutritional supplement sachet, 2 gm/sachet) sachet, haemocoagulase drops (10ml), glycin irrigation- (3ltr), glycerin-(100ml), glycerin & sodium chloride enema (20ml), glucose-sachets 75gm (dipsi-test), frusemide 10mg (30ml syp), framycetin sulphate 1% 10gm (skin cream), formoterol 6mcg with tiotropium 9mcg mdi 200 metered dose (inhalar), formaldehyde (5ltr), fluticasone propionate 50mcg (nasal spary) 120 meter d

CTN :39728946

04 Apr, 2025 9.99 Lacs

Multi City - Karnataka

Tender For purchase of consumables - folys catheter no 12, magnesium sulfate paste, abdominal drain 24, abdominal drain 22, surgical hernia mesh 7.5 cm x15cm, surgical hernia mesh, disposable adult diapers, romovac drain 14, romovac drain 16, malaria kit, urine pregnency test kit, h c v kit, disposable lancets, sodium citrate 3.2% blood collection tube, hiv safety kit, insuline syringe dispovan, skin stappler remover, oxy set twin bore nasal oxygen set size neo, infant feeding tube seven, infant feeding tube five, blood glucose strip with glucometer, urine analysis strips(protein/glucose), vdrl syphilis kit, five ml dispovan syringe, urine cups, surgical blade eleven, surgical blade twenty two, disposable needle 18 g, hbsag kit rapid, dispovan syringe, bandage than 100cmx20mt, vaccum-suck suction set, dengue test kit, h i v kit comb aids, blood grouping kit abd, clot activator tube , edta tube (purple ), plastic plane testtube, urine collection bag adult, unsterile surgical mop, splint no 2, splint no 1, phototherapy goggles-2 , surgical blade no 23, surgical blade no 15, pm-o- line, spinal needle 23g, dynaplaster, skin stappler, soft roll 15cmx 3m (cost padding), disposable ot caps, non steril gloves medium size, baby diapers, disposable baby sheet, card clamp, easy fix, spirit bottle 400ml, folys catheter no 14, scanning gel 5 liters ultra sound gel

CTN :39739215

08 Apr, 2025 20.00 Lacs

Kangra - Himachal Pradesh

Tender For nit for the purchase of lab reagents - (n/10) hydrochloride solution (haemoglobin estimation) 500ml, (n/10) hydrochloride solution (haemoglobin estimation) 100ml, haematology test reagent for automated haematology analyzer (3 part) sysmex-kx 21, stromatolyser (3 x 500)ml, stromatolyser (3 x 500)ml, tri level controls (each), cell pack 20 ltr, paper roll (53mm) each roll, pm kit kx 21, calibrator for kx-21, haematology test under microscope, wbc diluting fluid (tlc) 100 ml, total eosinophil count fluid 100 ml, rbc diluting fluid (total blood cell count) 100ml, platelet diluting fluid (platelet count) 100ml, distil water 5 ltr, blood grouping (abo-rh typing)anti abd ( 3 x 10 ml), blood grouping (abo-rh typing)anti- h 10 ml, anti-a1 5 ml, bovine albumin 10 ml, ahg 5ml, jsb stain-i, jsb stain-ii (malaria parasite) 500 ml, jsb stain-i, jsb stain-ii (malaria parasite) 125 ml, copper sulfate 500 gm pack, 3.8% sodium citrate solution (esr) 500 ml, coombs reagent (direct & indirect) (ahg anti c3d monoclonal) 10 ml, coombs reagent (direct & indirect) (ahg anti c3d monoclonal) 5 ml, laboratory stain (giema stain, leishman stain), giema stain 500 ml, leishman stain 500 ml, immersion oil (microscope) 30 ml, occult blood test, rpr card (syphilis)each, hiv rapid (each), hiv elisa method (each), rheumatoid factor (rh typing) 1 x 100 test, aso (each kit), crp (each kit), urine analysis reagent strip (as per packing), multistick (10 parametre) (as per packing), uri stick (2 parametre) (as per packing), pregnancy kit (pack of 100), widal kit (5 x 4 ml) (pack of 100), malaria rapid (each), dengue ns1 and igm combo kit (each), toxoplasma (rapid) (pack of 50), hepatitis b card test (tridot) (pack of 100), hepatitis b elisa method (pack of 50), hepatitis b card test (each card), hepatitis c card test (each card), hepatitis c elisa method (each ), troponin-i (pack of 10), h2s strip (each), biochemistry reagents (fully auto analyzer)erba em-200, blood sugar (lab method) (10x44 ml), blood sugar (glucometer strip) (pack of 100), blood sugar (10 x 44 ml), blood sugar (hexo kinase) each, blood urea (5 x 44 ml), s. creatinine jaffe s kinetic (5 x 44)ml, s. creatinine enzymatic (5 x 30 / 5 x 10 ml, s.bilirubin (t) (6 x 44) ml, s.bilirubin (d) (6 x 44) ml, sgot (6 x 44) ml, sgpt (6 x 44) ml, s.alkaline phosphatase (2 x 44) ml, s.alkaline phosphatase (2 x 22) ml, serum total protein (10 x 44) ml, serum albumin (10 x 44) ml, s. calcium (10 x 12) ml, s. amylase ( 5 x 22) ml, s. uric acid ( 5 x 44) ml, s. cholesterol (10 x 44) ml, s. triglyceride (5 x44) ml, s. triglyceride (5 x 22) ml, ldl-c (direct) (2 x 30) ml, s. hdl (4 x 30) ml, s. lipase (1 x 44) ml, ldh (2x44)ml, s. phosphorus, aso quantitative, crp quantitative, hb aic xl, magnesium estimation kit, serum iron, uibc, ferritin, ck-mb 2.11 ml, micro albumin, micro protein (10 x 12) ml, erba easylite machine (electrolyte), sodium electrode, potassium electrode, chloride electrode, membrane kit, tubing kit, electrolyte pack, electrolyte cleaning solution, internal filling solution, reference electrode, sample detector, wash solution, trilevel controls, other consumables, glass slide (grease free) 50ml (pack of 50), micro tips (yellow/ blue) (each), urine contrainer 50 ml (each), nverta k3 2ml vccume contanier (each), nvedta k2 2ml vccume contanier (each), plain vial vaccume contanier (each), yellow gel tube 4 x 5 ml (or 5ml) (each), sodium citrate tubes vaccume contanier (each), test tube (big) 12 x100 (each), test tube (glass) 18 x 150 (each), test tube (small) 12 x 75 (each), test tube stand (each), test tube holder (each), clotting vial vaccume contanier (each), esr stand (each), esr tube disposable (each), micro pipette(10-200) (each), micro pipette(5-50) (each), micro pipette(10-100) (each), micro pipette(100-1000) (each), tissue paper roll (each), fluoride vial vccume contanier (each), spirit lamp (each), disposable wintrobe tubes for esr (each), capillary tubes (each), cover slips (24 x60 mm) (

Liquor Amonia Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

State Government

Central Government/Public Sector

State Government

Central Government And Public Sector