Latest sodium carbonate Tenders | Government sodium carbonate Tenders

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

State Government

CTN :39200933

07 Apr, 2025 5.48 Lacs

Kutch - Gujarat

Tender For corrigendum : supply of fine chemical reagents & laboratory items for chemical laboratory at gsecl kltps - store code: 5910010029 1-amino 2-napthol 4-sulphonic acid, store code: 5931550041 ammonium molybdate ar ranbaxy, store code: 5931320001 barium chloride, store code: 5931330001 barium hydroxide lr, store code: 5915000002 barium sulphate, store code: 5934060001 benzyl alcohol, store code: 5916980008 bromothymol blue (ph 6.0-7.6), store code: 5930840001 calcium acetate ar, store code: 5916980014 erechrom black-t (solochrome black-t), store code: 5915760001 edta disodium salt ar/gr, store code: 5916600001 glycerol glaxo ar, store code: 5915980023 hydroxile amine hydrochloride, store code: 5915980025 indigo carmine, store code: 5933540001 oxalic acid ar, store code: 5916610003 methanol, store code: 5917200005 tarteric acid ar 500gms pkg, store code: 5932050001 methyl orange powder, store code: 5932050002 methyl red powder, store code: 5930890006 mercuric chloride, store code: 5930870003 magnesium chloride, store code: 5920200080 neda(1-napthyl ethylenediamine dihydrochloride), store code: 5950000017 nessler reagent, store code: 5934040003 iso-propal alchohol 2.50 ltrs. pack., store code: 5910051021 o tolidine reagent for chlorine testing 500 mls pack., store code: 5915980032 phenolphthalein powder, store code: 5930850027 potasium chloride 500 gram/bottle, store code: 5930850008 potassium cromate, store code: 5930850010 potassium di-hydrogen ortho-phosphate, store code: 5930850016 potassium iodate, store code: 5930850014 potassium hydroxide (pallets), store code: 5930850021 potassium permanganate powder, store code: 5930850023 potassium thiocynate, store code: 5930100002 silver nitrate, store code: 5910100001 sodium bi-carbonate, store code: 5910090005 sodium carbonate, store code: 5915350023 sodium hydroxide (pallets), store code: 5915350024 sodium meta bisulphite, store code: 5915350033 sodium thiosulphate, store code: 5930900002 stannous chloride, store code: 5932500002 starch, store code: 5915980035 sulphanil amide, store code: 5955030001 universal ph indicator solution 500 ml pack., store code: 5930120001 copper sulphate, store code: 5915350005 n/10 sodium thiosulphate ampouls, store code: 5945030001 pvc narrow mouth reagent bottle 1000 ml, store code: 5945030003 pvc narrow mouth reagent bottle 500 ml, store code: 5945030005 pvc wash bottle 500 ml, store code: 5945030006 pvc wide mouth reagent bottle 1000 ml, store code: 5945030008 pvc wide mouth reagent bottle 500 ml, store code: 5945600004 pvc buckets-15ltr

State Government

CTN :39790096

17 Apr, 2025 NA

Guwahati - Assam

Tender For empanelment of agencies for supply of different chemicals and reagents for various water testing laboratories under jal jeevan mission, assam. - ph test(i)buffer tablet ph 4.0 ar / gr grade, (ii)buffer tablet ph 7.0 ar / gr grade, (iii)buffer tablet ph 9.2 ar / gr grade, (iv)buffer tablet ph 10.01ar / gr grade, (v)ph paper strips packetsar / gr grade, tds test(i)potassium chloride ar / gr grade, (ii)whatman filter paper grade 542ar / gr grade, turbidity test(i)hydrazine sulphate (solid)ar / gr grade, (ii)hexamethylene tetramine (solid)ar / gr grade, chloride test(i)potassium chromate (solid)ar / gr grade, (ii)sodium chloridear / gr grade, (iii)silver nitratear / gr grade, (iv)n/50 silver nitrate solution (0.02 n)ar / gr grade, total alkalinity test(i)n/50 (0.02 n) sulphuric acid ar / gr grade, (ii)phenolphthalein (solid) ar / gr grade, (iii)anhyd. sodium carbonatear / gr grade, (iv)ethanol (100 % pure liquid) ar / gr grade, (v)methyl redar / gr grade, (vi)bromocresol green ar / gr grade, (vii)methyl orange solid ar / gr grade, sulphate test(i)barium chloride crystals (20-30 mesh) ar / gr grade, (ii)anhydrous sodium sulphatear / gr grade, (iii)conc. hclar / gr grade, (iv)95 % ethyl alcoholar / gr grade, (v)sodium chloridear / gr grade, (vi)glycerolar / gr grade, (vii)magnesium chloride hexahydratear / gr grade, (viii)sodium acetate ar / gr grade, (ix)glacial acetic acidar / gr grade, (x)potassium nitrate ar / gr grade, total hardness test(i)n/50 (0.02 n) edta liquid ar / gr grade, (ii)ammonium buffer solution ar / gr grade, (iii)erichrome black t (solid)ar / gr grade, (iv)triethanol amine (liquid)ar / gr grade, (v)sodium hydroxidear / gr grade, (vi)ethanol (100 % pure liquid) ar / gr grade, (vii)edta disodium salt ar / gr grade, (viii)magnesium sulphate heptahydratear / gr grade, (ix)ammonium hydroxidear / gr grade, (x)ammonium chloridear / gr grade, (xi)calcium carbonatear / gr grade, (xii)murexidear / gr grade, iron test(i)ammomium acetatear / gr grade, (ii)hydroxylamine hydrochloridear / gr grade, (iii)1,10 phenathroline monohydratear / gr grade, (iv)ferrous ammonium sulphatear / gr grade, (v)conc sulphuric acid ar / gr grade, (vi)conc. hclar / gr grade, (vii)glacial acetic acidar / gr grade, (viii)potassium permanganatear / gr grade, (ix)sodium acetate ar / gr grade, (x)potassium iodide (solid) ar / gr grade, arsenic test(i)stannous chloride (solid)ar / gr grade, (ii)lead acetate (solid)ar / gr grade, (iii)silver diethyldithiocarbamate (solid powder) ar / gr grade, (iv)glass wool ar / gr grade, (v)conc. hclar / gr grade, (vi)standard arsenic solution (1000 ppm)ar / gr grade, (vii)morpholine solution (liquid)ar / gr grade, (viii)chloroform (liquid)ar / gr grade, (ix)acetone liquid ar / gr grade, (x)sodium borohydridear / gr grade, (xi)calcium chloride anhydrous ar / gr grade, fluoride test(i)tisab-iiiar / gr grade, (ii)sodium chloridear / gr grade, (iii)glacial acetic acidar / gr grade, (iv)sodium hydroxidear / gr grade, (v)ctda (trans 1,2-diaminocyclohexane n,n,n,n tetraacetic acid)ar / gr grade, (vi)reference electrode solutionar / gr grade, (vii)spadnsar / gr grade, (viii)zirconyl chloride octahydrate (zrocl2 8h2o)ar / gr grade, (ix)anhydrous sodium fluoride (naf)ar / gr grade, (x)sodium arsenite (naaso2ar / gr grade, (xi)ureaar / gr grade, nitrate test(i)anhydrous sodium sulphite ar / gr grade, (ii)antimony metalar / gr grade, (iii)chloroformar / gr grade, (iv)potassium nitratear / gr grade, (v)conc. h2so4ar / gr grade, (vi)conc hclar / gr grade, (vii)chromotropic acid (crystal)ar / gr grade, (viii)acetic acid (glacial)ar / gr grade, free residual chlorine (new methode)(i)anhydrous disodium hydrogen phosphate (na2hpo4)ar / gr grade, (ii)potasium dihydrogen phosphate (kh2po4)ar / gr grade, (iii)disodium edta dihydrate (c10h14n2o8na2. 2 h2oar / gr grade, (iv)n,n-di-ethyl 1,4- phenylenediamine sulphate (dpd)ar / gr grade, (v)pottassium iodide, crystalar / gr grade, (vi)sulphuric acid (h2so4)ar / gr grade, (vii)sodium hydrox

CTN :39724261

01 Apr, 2025 NA

Jammu - Jammu And Kashmir

Tender For corrigendum : supply of management support , chemicals and glass ware equipments for rate contract on l1 basis - hpcl grade acetonitrile 2.5 ltr, hpcl grade water 1.00 ltr, disodium hyrogen citrate sesquihydrate 500 gm, primay secondary anemia (psa), silica gel 90 c 500 gm, anhydrous sodium acetate (ar) 500 gm, chlorpyripphos (crm), thiamethoxam (crm), imidacloprid (crm), cypermethrin (cmr), spiromesifen (crm), ptfe membrane filter for syringe 0.22 micron 1pck of 50 each, dichloromethane (hplc grade), n-hexane (hplc grade), ethyl acetate (hplc grade), syringe (10-25 microliters), flourisil, nitric acid ar grade, perchloric acid (ar grade), deionised water, standards of elements (nitric acid matrix) 1000 ppm, hydrogen peroxide, pipette - 1-5 ml, pipette - 200-1000 ml, pipette - 20-200 ml, hot plate, beaker 25 ml, beaker 250 ml, beaker 500 ml, beaker 100 ml, volumetric flask 25 ml, volumetric flask 250 ml, volumetric flask 500 ml, volumetric flask 1000 ml, conical flask 25 ml, conical flask 250 ml, conical flask 500 ml, conical flask 1000 ml, burette 25 ml, burette 50 ml, tatration stand, tongs, spatula, measuring cylinders 25 ml, measuring cylinders 250 ml, measuring cylinders 500ml, measuring cylinders 1000 ml, fehling solution a 500 ml, fehling solution b 500 ml, hydrochloric acid 500 ml, sucrose 500 gm, sodium carbonate 500 gm, methylene blue indicator 125 ml, iodine solution 250 ml, sodium hydroxide 500 gm, sulphuric acid 500 ml, sodium thio sulphate 500 gm, starch 500 gm, pot. terrocyanide 500 gm, zinc acetate, sodium bisultate 500 gm

corporations/Associations/Others

CTN :39816385

15 Apr, 2025 NA

Delhi - Delhi

Tender For supply of dental surgical consumables and chemicals - disposable needles 18 gauge 1 point 5 length , disposable needles 23 by 24 gauge 1 length , disposable needles 26 gauge 1 point 5 length , cotton bandage roll , bandage than absorbant gauge cloth , 5 percent w by v povidone iodine solution , 2 point 45 percent glutaraldehyde solution , absorbant cotton roll , disposable sterile sample culture bottle , desnet aldehyde and phenol free non corosive environment 1 lit , disposable non woven bedsheet blue , sterile disposable syringe with needle 10 ml syringe with 21 gauge , sterile disposable syringe with needle 2 ml syringe with 24 gauge 1 needle , sterile disposable syringe with needle 5 ml syringe with 24 gauge 1 needle , elastic zinc oxide self adhesive bandage , edta non vaccum blood collection tube 4ml , latex medical examination gloves powdered iso certified medium bar small , absorbent cotton gauze than , glucostrip-accu sure soul one box of 100 strips , glucostrip-codefree one box of 50 strips , non-woven disposable bouffant head cap with elastic band blue colour , non-woven disposable hiv pack for personal protection for hospital use sterile , hydrogen peroxide , inj diclofenac sodium ip , insulin syringe with fixed 30g bar 31g needle , local anaesthesia 2percentage lignocaine hydrochloride with adrenaline , microporous surgical adhesive tape , nitrile gloves for examination size medium powder free blue3 colour , normal saline sodium chloride inj ip , plain vacutainer non vaccum blood collection tube 4ml red colour , alcohol based hand sanitizer , chlorhexidin gluconate ip , disposable shoe cover non woven fabric blue colour elastic band for fit , silk suture 3 hypen 0 three bar 8 circle 16 mm 12pcs , silk suture 3 hypen 0 ns 5028 seam silk three bar 8 circle 26 mm 12 pcs , silk suture 4 hypern 0 one by two circle 16mm , silk suture 4 hypen 0 3 by 8 circle 16mm , silk suture 5 hypen 0 3by8 circle 16mm , 3 percent sodium hypochlorite for dental use , sodium hypochlorite 5 percent by 10percent , soframycin ointment 30g , 3ply surgical face mask , sterile surgical latex gloves 6.5 , sterile surgical latex gloves 7 , disposable non woven surgical gown , surgical spirit for hospital use , detachble bard parker surgical blade no 11 stailess steel , detachble bard parker surgical blade no 15 , toilet paper roll plai white 2ply , vaseline white softparaffin , polyglactin absorbable suture 3 point 0 90cm length , polyglactin absorbable suture 3 point 0 70 to 90 cm length , polygactin absorbable suture 4 poit 0 , lignocaine hydrochloride jelly , copper sulphate , coverslips 22mm 50mm point zero eight to point one three mm thickness , creatinine kit , crystal violete 125 ml , dextrose glucose , disposable high profile blade for microtome , disposable plastic tissue embedding ring , dpx mountant , ethanol , filter paper whatmen , formalin 5lt , fructose , glass slide 50psc , glass slides , god by pod sugar kit , gram iodine , hydrochloric acid , hydrochloric acid nby10 hcl , immersion oil , inoculating loop with holder , isopropyl alcohol , leishman stain , liquid ammonia , litmus paper blue , litmus paper red , maltose , may grunwald giemsa stain , methylene blue , molisch reagent , paraffin wax , protein estimation kit , saffranine , sodium carbonate , sodium nitroprusside , specimen jar with lid , sucrose , sulphur powder , sulphuric acid , test tubes 15 125mm , test tubes 15 150mm , uric acid kit , xylene , yellow tips

Central Government And Public Sector

CTN :39731236

29 Mar, 2025 NA

Thane - Maharashtra

Tender For supply of acetonitrile hplc grade cas no. 75-05-8 , ammonium acetate cas no. 631-61-8 , ascorbic acid cas no. 50-81-7 , buffer capsules ph 4.00 20 deg c , buffer capsules ph 7.00 at 20 deg c , buffer capsules ph 9.20 at 20 deg. c , citric acid monohydrate cas no. 5949-29-1 , hydrochloric acid cas no. 7647-01-0 , methanol for hplc cas no. 67-56-1 , methanol specially dried for karl fischer reagents , oxalic acid cas no. 6153-56-6 , single reagent residual free chlorine test kit , sodium carbonate anhydrous cas no. 497-19-8 , sodium hydroxide pellets cas no. 1310-73-2 , sulphuric acid cas no. 7664-93-9

CTN :39740288

08 Apr, 2025 34.15 Lacs

Delhi - Delhi

Tender For supply of consume - dept of ctvs surg, human thrombin gelatin matrix 5ml (floseal), aortic punch 3mm, aortic punch 3.5mm, non absorbable temporary pacemaker electrode fep-13e,17mm,/1/2c, taper cut ,v-58,60mm straight reserve cutting ,ks breakway/auto-cassablepoint (box of 12), surgical sealant - synthetic polyethylene glycols(pegs), na dilute hydrogen chloride solution(hci) and a sodium phosphate/sodium carbonate solution -4ml, iodine impregnated transparent incise drape large (ioban ),60x45 cm, snugger set paediatric, snugger sets adult, snugger set neonatal, non absorbable temporary pacemaker electrode fep 15e 26mm needle 1/2c, taper cut, v-7,60mm straight reverse cutting , ks breakway / auto-cassable point

CTN :39741148

08 Apr, 2025 NA

Bhopal - Madhya Pradesh

Tender For lab equipment and other during /2024-25 - group 1 - chemicals and disinfectants, phenol crystals (carbolic acid) 500gm, sulphuric acid 500ml, sodium hypochlorite 5 liter, methylene blue 25gm, potassium dichromate, basic fuchsin 25gm, immersion oil heavy grade liquid paraffin 30ml, sodium hydroxide pellets 500gm, tri sodium citrate 500gm, disodium hydrogen phosphate 500gm, potassium dihydrogen phosphate (anhydrous) 500gm, n-acetyl-l cystein 100gm or 250gm, potassium permanganate (kmno4) 500gm, formaldehyde 500ml, magnesium sulphate 500gm, magnesium citrate (tribasic) 500gm, asparagine 500gm, malachite green 500gm, glycerol 500ml, para nitro benzoic acid- 500ml, sodium chloride 500gm, brain heart infusion agar 500gm, sodium carbonate 500gm, oxalic acid 500gm, auramine o 25gm, hydrochloric acid 500ml, immunochromatographic test (rapid identificationtest) for mtb 1x25 kit, group 3- personal protective equipment (ppe), latex gloves (size- small) 100nos, latex gloves (size- medium) 100nos, latex gloves (size- large) 100nos, laboratory coats (size- small) 01nos, laboratory coats (size-medium) 01nos, laboratory coats (size-large) 01nos, surgical gowns (size- small) 01nos, surgical gowns (size- medium) 01nos, surgical gowns (size- large) 01nos, group 4a - pipettes tips for phenotypic use, 1-200 l pipette tips 1x96 tips, 20-200 l pipette tips 1x96 ", 100-1000 l pipette tips 1x96 ", 100-1000 l pipette tips (long tip) 1x96 ", pasteur pipettes (sterile individually packed), group 4b - pipettes tips for molecular use, 1-10 l pipette tips 1x96, 1-20 l pipette tips 1x96, 1-200 l pipette tips 1x96 tips, 20-200 l pipette tips 1x96, 10-100 l pipette tips 1x96, 100-1000 l pipette tips 1x96, pasteur pipettes 1x96, group 4b - pipettes tips for molecular use, culture tubes or universal glass bottles (mccartney bottles) 50ml (1 x 100) or (1 x 50), slides 10 kit (50 slides), glass ware flat bottom flask -1 lit, glass ware for stain preparation measuring cylinder - graduated 100 ml, measuring cylinder-graduated 500 ml, measuring cylinder-graduated 1000 ml, glass stoppered bottles -250 ml, container for stain -250 ml polyethylene, flat bottom flask - 5 lit, flat bottom flask - 1 lit, glass beaker- 500ml, glass beaker- 250ml, glass beads (5 mm), beaker- 250 ml, beaker- 100 ml, beaker- 500 ml, beaker- 1000 ml, funnels - 5 cm diameter, funnels - 10cm diameter, funnels - 18cm diameter, volumetric flask - 100 ml, volumetric flask - 1000 ml, 2 lit bottle- amber colour, 1 lit reagent bottle transparent, 500 ml reagent bottle- transparent, 250 ml. reagent bottle- transparent, group 6- disposable items, 50 ml polypropylene (pp) tubes for centrifuge (sterile), 15 ml polypropylene (pp) tubes for centrifuge (sterile), micro-centrifuge tube, sterile with cap, 1.5 ml, na, cryo-vial, sterile with cap, 2 ml (for long term storage), cryo vial storage boxes (1 x 50), cryotag 1 x 1000 per, bags for waste bin 60 litres, bags for waste bin 30 litres, bags for waste bin- 2 litres, single use syringes, sterile- 10 ml 50pcs, na, syringe filter (0.22um) for single use, sterile, filter paper sheets (for work benches) 100 sheet, single-use paper towels 100nos, tissue rolls, 2 ml standard reaction tube, pcr tubes (0.2 ml), forceps, individually wrap, sterile 50nos, petri dishes (plastic) 20per kg, disposable loops 10 l, group 7- general lab items, loop holders 1nos, loop wire 1nos, loop wire 1nos, inoculation loops 4mm 1nos, inoculation loops 3mm 1nos, diamond marker pencil 1 x 6", cotton .5kg, filter paper (for sputum microscopy reagents), stainless steel tray, perforated baskets 1 nos, wire rack, discard bucket with lid (10l), discard bins (2l), forceps (stainless steel) 1 x 6", stainless steel scissors 1 x 6", spatula 1 nos, boxes (for holding petri dishes), stainless steel trays, stainless steel funnel 1 nos, drying racks 1nos, brown paper 1 nos, rubber bands, cotton thread 1 x10 rolls, wire racks to hold mccartney bottles 1 nos, stainless steel rods for staining 1 nos, indust

Central Government And Public Sector

CTN :39540988

03 Apr, 2025 21.5 Thousand

Karwar - Karnataka

Tender For corrigendum : supply of chemicals to krims, karwar - ethyl alcohol 500ml for biochemistry (karwr), casien 500grm (karwr), sodium lauryl sulfate 500grm (karwr), methylmalonic acid 25grm (karwr), oxaloacetic acid 5grm (karwr), amido black 10b 100grm (karwr), p- dimethyl benzaldehyde 500grm (karwr), cholesterol 100grm (karwr), four-nitroaniline 250grm (karwr), demthyl amine 500ml (karwr), dimethyl sulphoxide 500ml (karwr), magnesium chloride 500grm (karwr), sodium salicylate 500grm (karwr), phosphotungustic acid 100grm (karwr), o-cresolphthlein complexone 5grm (karwr), succinic acid 500grm (karwr), eight-hydroxy quinoline 100grm (karwr), buffer capsule (karwr), brij (30 percent) 500ml (karwr), one-nitroso-2napthol 25grm (karwr), bromophenol blue 25grm (karwr), agarose medium 25grm (karwr), potassium dihydrogen orthophoshate 500grm (karwr), sodium chloride 500grm (karwr), di- acetyl monoxime 100grm (karwr), uric acid 100grm (karwr), creatinine 100grm (karwr), calcium chloride 500grm (karwr), lead oxide 500grm (karwr), cupric acetate 500grm (karwr), sulphur powder 500grm (karwr), conc .hydrochloric acid 5litrre (karwr), conc sulphuric acid 5litrre (karwr), conc.nitric acid 2.5litre (karwr), trichloro acetic acid 500grm (karwr), tris buffer 500grm (karwr), picric acid 500grm (karwr), thiosemicarbazide 500grm (karwr), tartaric acid 500grm (karwr), sulphosalycilic acid 500grm (karwr), starch 500grm (karwr), sodium dihydrogen orthophosphate 500grm (karwr), sodium pyuruvate 25grm (karwr), sucrose 500grm (karwr), sodium acetate 500grm (karwr), sodium tungustate dihydrate 100grm (karwr), resorcinol 500grm (karwr), phenyl phosphate disodium salt 25grm (karwr), potassium ferricynide 500grm (karwr), potassium sodium tartarate 500grm (karwr), potassium dichromate 500grm (karwr), phenyl hydrazine hydrochloride 500grm (karwr), pottasiun iodide 250gr (karwr), peptone 500grm (karwr), phenol crystals 500grm (karwr), oxalic acid 500grm (karwr), napthol 100grm (karwr), ninhydrine 100grm (karwr), methyl red solution 125ml (karwr), mercuric sulphate 250grm (karwr), molybdic acid 100grm (karwr), magnesium sulphate 500grm (karwr), maltose 500grm (karwr), metol 500grm (karwr), l-alanine 500grm (karwr), l-aspartic acid 100grm (karwr), leadacetate (anhydrous) 500grm (karwr), lactose 500grm (karwr), gelatin powder 500grm (karwr), ferric chloride anhydrous 500ml (karwr), formaldehyde 500ml (karwr), ethylene diamine tetraacetic acid 100grm (karwr), dipottasium oxalate 500grm (karwr), diphenyl amine 100grm (karwr), d- ribose 25grm (karwr), dexrose 500grm (karwr), dinitro phenyl hydrazine 500grm (karwr), d-fructose 500grm (karwr), calcium carbonate 500grm (karwr), coumasssie brilliant blue 25grm (karwr), chromatograph sheets 25units (karwr), chloroform 2.5litre (karwr), butanol 500ml (karwr), bromocresol green 100grm (karwr), barium chloride 500grm (karwr), amino acid kits (24nitem) 2box (karwr), iso-amyl alcohol 500ml (karwr), acetic anhydrous 500ml (karwr), alpha-keto glutaric 25grm (karwr), four-amino antipyrine 100grm (karwr), l-ascorbic acid 500grm (karwr), ammonium persulphate 500grm (karwr), one amino, 2-napthol,4-sulphonic acid 100grm (karwr), maglumi trop-i (karwr), maglumi ck-mb (karwr), fully automated analyser (xl) amylase 5x11ml (karwr), fully automated analyser (xl) d-dimer control( r1-5x1ml, r2- 5x1ml) (karwr), fully automated analyser (xl) ferritin control(1x1ml) (karwr), fully automated analyser (xl) crp control (1x1ml) (karwr), fully automated analyser (xl) ferritin with calibrator (r1- 2x14.5ml ), r2- 2x7.7ml (karwr), fully automated analyser (xl) d-dimer with calibrator( r2-1x4 ml) (karwr), sodium bisulphate 500gm (karwr), benzidine reagent 500ml (karwr), nitric acid 2.5l (karwr), acetone 2.5 l (karwr), sodium sulphite 500gm (karwr), sodium hypobromite 500ml (karwr), silver nitrate 500gm (karwr), sodium bisulphite 500gm (karwr), sodium hydroxide pellets 5 kg (karwr), sodium carbonate 500gm (karwr), glacial acitic acid 500ml (karwr), iodine 1

CTN :39567888

26 Mar, 2025 NA

Sagar - Madhya Pradesh

Tender For supply of items and equipment for botany, zoology,physics, chemistry and geography laboratory - name of equipment -geography lab, plain table set, prismatic compass, weather maps set, chain tape set, compass 100mm, levelling staff 4meter, illuminating, globe 3 dimensional physical, illuminating, globe 3 dimensional political, photo of great geographers, relief maps of india, topo sheets ( survey of india), set of 25 non-metallic minerals for industrial use, ranging rod, almirah (full size), name of equipment -zoology lab, digital single pan balance 300gm, digital ph meter, digital thermometer, haemocytometer(complete box), sphygmomanometer, compound microscope, water distillation apparatus 4lit. s.s., electrophoresis submarine with power supply, centrifuge machine doctor model 8tubes, haemoglobinometer, spectrophotometer, almerah, slides, coverslip, cavity slide, test-tube, beaker ( 50 ml ,100 ml,250 ml ), watch glass 3 , conical flask (100 ml , 250 ml), tissue paper, filter paper, models, specimens, permanent slides, (d human skleton model, name of equipment -chemistry lab, beaker ( 50 ml , 100 ml , 250 ml), burette 50ml, conical flask ( 50 ml , 100 ml , 250 ml, pipette ( 10 ml , 25 ml ), volumetric flask (100ml , 250 ml , 500 ml ), watch glass 3 , spatula, glass rod, measuring cylinder (50 ml , 100 ml ), funnel 75mm, test-tubes, tripod stand, burette stand, glass slides pkt, bunsen burner, desiccator, ignition tube, glass bottles 250ml, sprayer, filter paper, whatmann filter paper no.1, chromatographic jar, tlc kit, corks, test-tube stands, vaccum pump, distillation unit s.s. 4lit., reflux unit, round bottom flak 250ml, digital chemical balance, thermometer, colorimeter, ph-meter, theles-tube, water bath /sand bath, almirah, sodium chloride 500gm, anti a, b,d (3x10ml), methanol 500ml, acetocarmin 100ml, xylol (xylene) 500ml, canada balsam 100ml, eosin 125ml, glycerine 500ml, potassium hydroxide 500gm, sodium hydroxide 500gm, chloroform ( 500 ml ), d p x mountant 250ml, distill water 5lit., acetone 500ml, acetic acid 500ml, ammonium chloride 500gm, sodium sulphate 500gm, acetanillide (500gm), ammonium acetate 500gm, ammonium ferrous sulphate (500gm), ammonium carbonate(500gm), benzoic acid 500gm, copper sulphate (500gm), conc. hydrochloric acid 500ml, conc. sulphuric acid 500ml, calcium chloride (500gm), chloroform ( 500 ml ), ethyl alcohol ( 500 ml ), ethyl acetate ( 500 ml ), ferric chloride (500gm), fehling solution a 500ml, fehling solution b 500ml, glacial acetic acid ( 500 ml ), glycerine ( 500 ml ), ferrous sulphate (500gm), iodine (100gm ), nepthalene (500gm), nitric acid ( 500 ml ), alpha naphthol (100gm), beta nephthol (250gm), oxalic acid (500gm), phenyl hydrazine 250ml, potassium dichromate (500gm), potassium permanganate(500gm), phenophthalein 125ml, phthalic acid 500gm, phenol 500gm, resorcinol 250gm, sodium metal 100gm, sodium carbonate (500gm), sodium nitrite (500gm), salicylic acid (500gm), starch 500gm, sucrose (500gm), silica gel g for tlc 500gm, zinc dust 500gm, buffer tablets ( 4,9,7 ) 10tab. each pack, benedict solution 500ml, molisch reagent 125ml, silver chloride 25gm, lead acetate (500gm), methylene blue 125ml, nesslers reagent 100ml, methyl orange 125ml, urea crystal (500gm), calcium carbonate (500gm), edta solution 500ml, pot. chloride (500gm), diethyl ether (500 ml ), dimethyl glyoxime (100gm), ammonium hydroxide (500ml), ferric sulphate (500gm), magnesium chloride (500gm), zinc chloride (500gm), silver nitrate (25gm), barium chloride (500gm), manganese sulphate (500gm), aluminum sulphate (500gm), pot. nitrate (500gm), sodium acetate (500gm), aluminium foil, formaline 500ml, acetone( 500 ml ), safranine sol. 125ml, haematoxylin 125ml, crystal violet-used to stain bacteria 125ml, name of equipment -botony lab, petri dish 3 , watch glass 3 , wash bottles plastic 500 ml, wash bottles plastic 250ml, cover silp 22mm blue star, plain slides, flasks ( 100 ml , 50 ml , 200 ml ), beaker ( 50 ml ,100 ml,200

Sodium Carbonate Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

State Government

State Government

corporations/Associations/Others

Central Government And Public Sector

Central Government And Public Sector