Latest sodium carbonate Tenders | Government sodium carbonate Tenders

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39357843

28 Mar, 2025 NA

Ranchi - Jharkhand

Tender For bid to ras tender for supply of zidovudine 300mg plus lamivudine 150mg plus nevirapine 200mg tab , nitrofurantoin 100 mg tab , tab thyroxin sodium 75 mcg , inj nitroglycerineoblique glyceryltrinitrate 5 mg , syp zinc 20 mgoblique 5 mlcoma bottle of 100 ml , dexamethasone 4 mg , tab dienogest ip 2 mg , inj leuprolide 3point75 mg , bisoprolol 2point5 mg tab , carvediolol 6point25 mg tab , propranolol 10 mg tab , trimetazidine 20 mg tab , misoprostol 200 mcg tab , prednisolone 10 mg tab , voglibose 0point3 mg tab , hepatitis b vaccine 10 ml , inj hepatitis b immunoglobin 100iuoblique1ml , tetanus toxoidcoma purified absorbed rubber cappedcoma vial of 5 ml , alprazolam 0point5 mg tab , cilnidipine 10 mg tab , clobazam 10 mg tab , deflazacort 12 mg tab , deflazacort 30 mg tab , entecavir 1 mg tab , ethambutol 1 gm tab , etoricoxib 60 mg tab , gabapentin 100 mg tab , hydrochlorothiazide 12point5 mg tab , lacosamide 50 mg tab , lorazepam 2 mg tab , methylcobalamin 500 mg tab , metoprolol 25 mg tab , mouth ulcer gel tube of 10 gm , naproxen 500 mg tab , paracetamol suppositories 150 mg , piracetam 800 mg tab , rosuvastatin 20 mg tab , serratiopeptidase 10 mg tab , serratiopeptidase 5 mg tab , sodium valproate 500 mg cr tab , telmisartan 20 mg tab , vitamin e 400 mg cap , inj phenytoin sodium 50 mgobliquemlcoma 2ml ampoule , inj clindamycin 600 mg , iron sucrose 20mg inj vial of 1 ml , inj mephentermine inj mephentine , vitamin d3 400 iu cholecalciferol drops bottle of 15ml , vitamin d3 800 iu cholecalciferol drops bottle of 15ml , inj phytomenadione vitamin k 10 mgobliqueml , ddes125 solution , tab tadalafil 20mg , tab ambrisertan 5mg , polyethylene glycol sachet 7 grams , syp calcium with phosphorus calcium 82plusphosphorus 41mgoblique5ml , vigabatrin powder for oral solution usp 500 mg sachet , surgical suction with vaccum tube and yankauer nozzle , adult diapers pkt of 10 size smallcoma medium and large assorted size , vac gel foam dressing size small with canister , vac gel foam dressing size medium with canister , colostomy kit with accessories , colostomy kit with belt care paste base cover tube , one touch select glucose strips bott of 50 strips , single foiled beta ketone strips 10 strips per box compatible optium neo h blood

CTN :39562316

28 Mar, 2025 NA

Patiala - Punjab

Tender For bid to ras supply of 500mg tab , mebeverine 135 mg tab mebaspa , metoprolol xl 12.5 mg tab , mirabegron 25mg tab cap , mirabegron 50 mg tab , multivitamin syp , nasal spray calcitonin 200iu , nebivolol 5 mg tab , nintedanib 150 mg cap , pancreatin 10000 iu tab , paroxetine 12.5mg tab , prasugrel 10 mg tab , pregablin 75 mg , prucalopride 2 mg tab , rabeprazole 20mg plus itopride 150mg tab , ranolazine 500 mg tab , rifaximine 400mg tab , sacubitril 97mg plus valsartan 103mg tab , salbutamol 200 mdi each metered dose supplies 100mcg of salbutamol mdi , salmeterol 50mcg plus fluticasone propionate 250mcg seretide accuhaler 50 250 , serratiopeptidase 10 mg tab , sertraline 50 mg tab , sevelamer foseal 800 mg tab , silodosin 4 mg tab , sodium valproate 500 mg tab , sofosbuvir 400mg plus velpatasvir 100mg cap , solifenacin 10 mg tab , spironolactone 50 mg aldectone , syp cough expectorant 100 ml , syp lactulose 200 ml , syp peractin cyproheptadine , tadalafil 5 mg , telmisartan 40 mgplusamlodipine 10 mg tab , tenofovir alafenamide 25 mg tab , tetrabenzeme 25mg tab , torsemide 40 mg tab , trimetazidine 20 mg tab , trimetazidine 60 sr tab , trypsin chymotrypsin diclofenac chymoral forte d tab , ursodeoxycholic acid 450 mg tab , ursodeoxycholic acid 600mg tab , ursodexycholic acid 300mg tab udiliv , vildagliptin 50mg tab , vit a d e c b1 b12 folic acid biotin menopace , volini gel tube of 50 gm linseed oil plus diclofenac plusmethyl salicylate plus menthol gel , zolpidem 10 mg tab , calcium carbonate plus calcitirol plus methulcobalamin plus vitamin k2 and zinc tab , chlordiazepoxide 5 mg plus clidinium bromide 2.5 mg librax 5 plus 2.5 , glimepiride 2mg plus metformin 500mg tab , glucosamine 500 mg pluschondriotin 400 mg tab , glucosamine 750 mg plus diacerine 50 mg tab , methylcobalamin 1500mcg plus alpha lipoic acid 100mg plus myo-inositol 100mg plus folic acid 1.5mg plus chromium picolinate 200mcg plus selenium 55mcg plus benfotiamine 150mg nuhenz cap , omega 3 fatty acid cap , polyethylene glycol purgative powder ip 118gm. sod chloride 2.93 gm pot chloride 1.484 gm sod bicarb 3.37 gm sod sulphate 11.35gm bid details/ 2 / 63

State Government

CTN :39200933

07 Apr, 2025 5.48 Lacs

Kutch - Gujarat

Tender For corrigendum : supply of fine chemical reagents & laboratory items for chemical laboratory at gsecl kltps - store code: 5910010029 1-amino 2-napthol 4-sulphonic acid, store code: 5931550041 ammonium molybdate ar ranbaxy, store code: 5931320001 barium chloride, store code: 5931330001 barium hydroxide lr, store code: 5915000002 barium sulphate, store code: 5934060001 benzyl alcohol, store code: 5916980008 bromothymol blue (ph 6.0-7.6), store code: 5930840001 calcium acetate ar, store code: 5916980014 erechrom black-t (solochrome black-t), store code: 5915760001 edta disodium salt ar/gr, store code: 5916600001 glycerol glaxo ar, store code: 5915980023 hydroxile amine hydrochloride, store code: 5915980025 indigo carmine, store code: 5933540001 oxalic acid ar, store code: 5916610003 methanol, store code: 5917200005 tarteric acid ar 500gms pkg, store code: 5932050001 methyl orange powder, store code: 5932050002 methyl red powder, store code: 5930890006 mercuric chloride, store code: 5930870003 magnesium chloride, store code: 5920200080 neda(1-napthyl ethylenediamine dihydrochloride), store code: 5950000017 nessler reagent, store code: 5934040003 iso-propal alchohol 2.50 ltrs. pack., store code: 5910051021 o tolidine reagent for chlorine testing 500 mls pack., store code: 5915980032 phenolphthalein powder, store code: 5930850027 potasium chloride 500 gram/bottle, store code: 5930850008 potassium cromate, store code: 5930850010 potassium di-hydrogen ortho-phosphate, store code: 5930850016 potassium iodate, store code: 5930850014 potassium hydroxide (pallets), store code: 5930850021 potassium permanganate powder, store code: 5930850023 potassium thiocynate, store code: 5930100002 silver nitrate, store code: 5910100001 sodium bi-carbonate, store code: 5910090005 sodium carbonate, store code: 5915350023 sodium hydroxide (pallets), store code: 5915350024 sodium meta bisulphite, store code: 5915350033 sodium thiosulphate, store code: 5930900002 stannous chloride, store code: 5932500002 starch, store code: 5915980035 sulphanil amide, store code: 5955030001 universal ph indicator solution 500 ml pack., store code: 5930120001 copper sulphate, store code: 5915350005 n/10 sodium thiosulphate ampouls, store code: 5945030001 pvc narrow mouth reagent bottle 1000 ml, store code: 5945030003 pvc narrow mouth reagent bottle 500 ml, store code: 5945030005 pvc wash bottle 500 ml, store code: 5945030006 pvc wide mouth reagent bottle 1000 ml, store code: 5945030008 pvc wide mouth reagent bottle 500 ml, store code: 5945600004 pvc buckets-15ltr

corporations/Associations/Others

CTN :39816385

15 Apr, 2025 NA

Delhi - Delhi

Tender For supply of dental surgical consumables and chemicals - disposable needles 18 gauge 1 point 5 length , disposable needles 23 by 24 gauge 1 length , disposable needles 26 gauge 1 point 5 length , cotton bandage roll , bandage than absorbant gauge cloth , 5 percent w by v povidone iodine solution , 2 point 45 percent glutaraldehyde solution , absorbant cotton roll , disposable sterile sample culture bottle , desnet aldehyde and phenol free non corosive environment 1 lit , disposable non woven bedsheet blue , sterile disposable syringe with needle 10 ml syringe with 21 gauge , sterile disposable syringe with needle 2 ml syringe with 24 gauge 1 needle , sterile disposable syringe with needle 5 ml syringe with 24 gauge 1 needle , elastic zinc oxide self adhesive bandage , edta non vaccum blood collection tube 4ml , latex medical examination gloves powdered iso certified medium bar small , absorbent cotton gauze than , glucostrip-accu sure soul one box of 100 strips , glucostrip-codefree one box of 50 strips , non-woven disposable bouffant head cap with elastic band blue colour , non-woven disposable hiv pack for personal protection for hospital use sterile , hydrogen peroxide , inj diclofenac sodium ip , insulin syringe with fixed 30g bar 31g needle , local anaesthesia 2percentage lignocaine hydrochloride with adrenaline , microporous surgical adhesive tape , nitrile gloves for examination size medium powder free blue3 colour , normal saline sodium chloride inj ip , plain vacutainer non vaccum blood collection tube 4ml red colour , alcohol based hand sanitizer , chlorhexidin gluconate ip , disposable shoe cover non woven fabric blue colour elastic band for fit , silk suture 3 hypen 0 three bar 8 circle 16 mm 12pcs , silk suture 3 hypen 0 ns 5028 seam silk three bar 8 circle 26 mm 12 pcs , silk suture 4 hypern 0 one by two circle 16mm , silk suture 4 hypen 0 3 by 8 circle 16mm , silk suture 5 hypen 0 3by8 circle 16mm , 3 percent sodium hypochlorite for dental use , sodium hypochlorite 5 percent by 10percent , soframycin ointment 30g , 3ply surgical face mask , sterile surgical latex gloves 6.5 , sterile surgical latex gloves 7 , disposable non woven surgical gown , surgical spirit for hospital use , detachble bard parker surgical blade no 11 stailess steel , detachble bard parker surgical blade no 15 , toilet paper roll plai white 2ply , vaseline white softparaffin , polyglactin absorbable suture 3 point 0 90cm length , polyglactin absorbable suture 3 point 0 70 to 90 cm length , polygactin absorbable suture 4 poit 0 , lignocaine hydrochloride jelly , copper sulphate , coverslips 22mm 50mm point zero eight to point one three mm thickness , creatinine kit , crystal violete 125 ml , dextrose glucose , disposable high profile blade for microtome , disposable plastic tissue embedding ring , dpx mountant , ethanol , filter paper whatmen , formalin 5lt , fructose , glass slide 50psc , glass slides , god by pod sugar kit , gram iodine , hydrochloric acid , hydrochloric acid nby10 hcl , immersion oil , inoculating loop with holder , isopropyl alcohol , leishman stain , liquid ammonia , litmus paper blue , litmus paper red , maltose , may grunwald giemsa stain , methylene blue , molisch reagent , paraffin wax , protein estimation kit , saffranine , sodium carbonate , sodium nitroprusside , specimen jar with lid , sucrose , sulphur powder , sulphuric acid , test tubes 15 125mm , test tubes 15 150mm , uric acid kit , xylene , yellow tips

CTN :39724261

01 Apr, 2025 NA

Jammu - Jammu And Kashmir

Tender For corrigendum : supply of management support , chemicals and glass ware equipments for rate contract on l1 basis - hpcl grade acetonitrile 2.5 ltr, hpcl grade water 1.00 ltr, disodium hyrogen citrate sesquihydrate 500 gm, primay secondary anemia (psa), silica gel 90 c 500 gm, anhydrous sodium acetate (ar) 500 gm, chlorpyripphos (crm), thiamethoxam (crm), imidacloprid (crm), cypermethrin (cmr), spiromesifen (crm), ptfe membrane filter for syringe 0.22 micron 1pck of 50 each, dichloromethane (hplc grade), n-hexane (hplc grade), ethyl acetate (hplc grade), syringe (10-25 microliters), flourisil, nitric acid ar grade, perchloric acid (ar grade), deionised water, standards of elements (nitric acid matrix) 1000 ppm, hydrogen peroxide, pipette - 1-5 ml, pipette - 200-1000 ml, pipette - 20-200 ml, hot plate, beaker 25 ml, beaker 250 ml, beaker 500 ml, beaker 100 ml, volumetric flask 25 ml, volumetric flask 250 ml, volumetric flask 500 ml, volumetric flask 1000 ml, conical flask 25 ml, conical flask 250 ml, conical flask 500 ml, conical flask 1000 ml, burette 25 ml, burette 50 ml, tatration stand, tongs, spatula, measuring cylinders 25 ml, measuring cylinders 250 ml, measuring cylinders 500ml, measuring cylinders 1000 ml, fehling solution a 500 ml, fehling solution b 500 ml, hydrochloric acid 500 ml, sucrose 500 gm, sodium carbonate 500 gm, methylene blue indicator 125 ml, iodine solution 250 ml, sodium hydroxide 500 gm, sulphuric acid 500 ml, sodium thio sulphate 500 gm, starch 500 gm, pot. terrocyanide 500 gm, zinc acetate, sodium bisultate 500 gm

State Government

CTN :39790096

17 Apr, 2025 NA

Guwahati - Assam

Tender For empanelment of agencies for supply of different chemicals and reagents for various water testing laboratories under jal jeevan mission, assam. - ph test(i)buffer tablet ph 4.0 ar / gr grade, (ii)buffer tablet ph 7.0 ar / gr grade, (iii)buffer tablet ph 9.2 ar / gr grade, (iv)buffer tablet ph 10.01ar / gr grade, (v)ph paper strips packetsar / gr grade, tds test(i)potassium chloride ar / gr grade, (ii)whatman filter paper grade 542ar / gr grade, turbidity test(i)hydrazine sulphate (solid)ar / gr grade, (ii)hexamethylene tetramine (solid)ar / gr grade, chloride test(i)potassium chromate (solid)ar / gr grade, (ii)sodium chloridear / gr grade, (iii)silver nitratear / gr grade, (iv)n/50 silver nitrate solution (0.02 n)ar / gr grade, total alkalinity test(i)n/50 (0.02 n) sulphuric acid ar / gr grade, (ii)phenolphthalein (solid) ar / gr grade, (iii)anhyd. sodium carbonatear / gr grade, (iv)ethanol (100 % pure liquid) ar / gr grade, (v)methyl redar / gr grade, (vi)bromocresol green ar / gr grade, (vii)methyl orange solid ar / gr grade, sulphate test(i)barium chloride crystals (20-30 mesh) ar / gr grade, (ii)anhydrous sodium sulphatear / gr grade, (iii)conc. hclar / gr grade, (iv)95 % ethyl alcoholar / gr grade, (v)sodium chloridear / gr grade, (vi)glycerolar / gr grade, (vii)magnesium chloride hexahydratear / gr grade, (viii)sodium acetate ar / gr grade, (ix)glacial acetic acidar / gr grade, (x)potassium nitrate ar / gr grade, total hardness test(i)n/50 (0.02 n) edta liquid ar / gr grade, (ii)ammonium buffer solution ar / gr grade, (iii)erichrome black t (solid)ar / gr grade, (iv)triethanol amine (liquid)ar / gr grade, (v)sodium hydroxidear / gr grade, (vi)ethanol (100 % pure liquid) ar / gr grade, (vii)edta disodium salt ar / gr grade, (viii)magnesium sulphate heptahydratear / gr grade, (ix)ammonium hydroxidear / gr grade, (x)ammonium chloridear / gr grade, (xi)calcium carbonatear / gr grade, (xii)murexidear / gr grade, iron test(i)ammomium acetatear / gr grade, (ii)hydroxylamine hydrochloridear / gr grade, (iii)1,10 phenathroline monohydratear / gr grade, (iv)ferrous ammonium sulphatear / gr grade, (v)conc sulphuric acid ar / gr grade, (vi)conc. hclar / gr grade, (vii)glacial acetic acidar / gr grade, (viii)potassium permanganatear / gr grade, (ix)sodium acetate ar / gr grade, (x)potassium iodide (solid) ar / gr grade, arsenic test(i)stannous chloride (solid)ar / gr grade, (ii)lead acetate (solid)ar / gr grade, (iii)silver diethyldithiocarbamate (solid powder) ar / gr grade, (iv)glass wool ar / gr grade, (v)conc. hclar / gr grade, (vi)standard arsenic solution (1000 ppm)ar / gr grade, (vii)morpholine solution (liquid)ar / gr grade, (viii)chloroform (liquid)ar / gr grade, (ix)acetone liquid ar / gr grade, (x)sodium borohydridear / gr grade, (xi)calcium chloride anhydrous ar / gr grade, fluoride test(i)tisab-iiiar / gr grade, (ii)sodium chloridear / gr grade, (iii)glacial acetic acidar / gr grade, (iv)sodium hydroxidear / gr grade, (v)ctda (trans 1,2-diaminocyclohexane n,n,n,n tetraacetic acid)ar / gr grade, (vi)reference electrode solutionar / gr grade, (vii)spadnsar / gr grade, (viii)zirconyl chloride octahydrate (zrocl2 8h2o)ar / gr grade, (ix)anhydrous sodium fluoride (naf)ar / gr grade, (x)sodium arsenite (naaso2ar / gr grade, (xi)ureaar / gr grade, nitrate test(i)anhydrous sodium sulphite ar / gr grade, (ii)antimony metalar / gr grade, (iii)chloroformar / gr grade, (iv)potassium nitratear / gr grade, (v)conc. h2so4ar / gr grade, (vi)conc hclar / gr grade, (vii)chromotropic acid (crystal)ar / gr grade, (viii)acetic acid (glacial)ar / gr grade, free residual chlorine (new methode)(i)anhydrous disodium hydrogen phosphate (na2hpo4)ar / gr grade, (ii)potasium dihydrogen phosphate (kh2po4)ar / gr grade, (iii)disodium edta dihydrate (c10h14n2o8na2. 2 h2oar / gr grade, (iv)n,n-di-ethyl 1,4- phenylenediamine sulphate (dpd)ar / gr grade, (v)pottassium iodide, crystalar / gr grade, (vi)sulphuric acid (h2so4)ar / gr grade, (vii)sodium hydrox

State Government

CTN :39796826

26 Mar, 2025 NA

Thiruvananthapuram - Kerala

Tender For purchase of cellulose microcrystalline powder, polyethylene glycol 6000, polyethylene glycol 400 and pvdf membrane filter

CTN :39803180

02 Apr, 2025 10.41 Lacs

Multi City - Karnataka

Tender For material supply for construction of womens self-help group sanjivini building at kattemalavadi village in hunsur tq under mnrega scheme-, add sundries charges at 1% on labour, , over head & other miscellaneous charges, , add sundries charges at 1% on material, , broken stone aggregate 40 mm size, , broken stone aggregate 20 mm size, , broken stone aggregate 12 mm to 10 mm size, , coarse sand (zone iii), , portland cement, , mixer (concrete) - 1 cum capacity, , add watering charges at 1% on material, , plasticizer / super plasticizer, , hom of vibrator 0.71 days, , granite metal 20 mm, , broken granite metal 10 mm, , mason class i (with tools), , concrete mixer 0.4/0.28 cum capacity, , add formwork and staging @ 20% for height upto 5 m, , add formwork @ 4% out of material and labour, , tmt bars fe 500, , binding wire, , size stone 20 x 20 x 25 cms, , bond stone 20 x 20 x 45 cm, , boulders, , mixer (concrete small used in culvert), , mason class ii (with tools), , stone chistler class ii, , add watering charges at 1% on labour, , brick, , casurina poles 100 - 150 mm, , add handling, loading and unloading at 1% on material, , add sundries charges at 2% on material, , add providing and removing scaffolding at 3% on labour, , vitrified tiles 600x600 mm, , ceramic tiles of size 30 x 30 cms, , white cement, , glazed tiles 300x450, , border tiles 30 x 10 cms, , add handling, loading and unloading at 2% on material, , add white cement for pointing at 2% on material, , broken granite metal 20 mm, , ms sheet 1 mm thick, , gusset plates 3.15 mm thick, , angle iron 40x40x6mm, , pintels including welded pins, , ms cleats with bolts and nuts to rest on pile, , hooks, , fitter class |, , add hom of welding and grinding machine @ 2% on material, , locking arrangements at 1% on a, , ready mix primer paint (ready mix red lead paint), , add wire brush, fine steel wool, putty, sand paper, at 3% on cost of paint, , painter class i, , mathi/nandi wood planks for panels 25 mm, , thick, , add cutting and other wastage 5%, , hom of machinaries for planing, , honne wood, , honnewood planks for panels 20 mm thick, , unit cost as per the specification, , powder coated 60-70 micron, , nylon rollers, , rubber beading for shutters beading, , pvc beading, , alluminium tower bolt - 20 cm, , alluminium handles - 15 mm, , cleat angles, , chrominum plated screws, , 5.50 mm thick plain glass, , fabricator, , m.s rods, , ms flat, , welder grade i, , add hom of welding and grinding machine @, , 4% on material, , enamel metal paint, , add brush at 1% on cost of paint, , 50 mm dia ms hollow pipe b class 14 gauge, , 20 mm x20mm vertical m.s square rod, , 12x12 m.s square rod, , anticorrosive bitumastic paint, , mechanic class ii/mechanic hmp grade i/eme grade, , hom of welding and grinding machine, , hom of cutting and grinding machine1, , tools and plants @2% on material, , transportation loading and unloading @1% on material, , dry distemper, , whitening, , add brush, putty, glue at 5% on cost of paint, , water proofing cement paint, , add brush, putty, sand paper at 2% on cost of paint, , enamel primer, , add brush, putty, sand paper at 5% on cost of paint, , enamel paint, , add brush, putty, sand paper, roller at 5% on cost of paint, , aluminium paint, , polyenthylene water storage tank of specified capacity l, , labour charges for lifting and placing in position and making connection at 7% on material, , handling loading and unloading 3% on material, , foreman grade 1, , granite metal 40 mm, , table moulded bricks of class designation 50( non modular), , c.i manhole cover with frame, , cost of centering at 1% on material, , pvc pipe of 6kg\cum,90 mm, , stone aggregate(single size):20 mm nominal size, , stone aggregate(single size): 10 mm nominal, , size, , polyethylene pipes high density 32 mm dia external dia, , add, , plumber, , add cement sand and grit 1% on material, , transportation charges of materials beyond 5 km @ 10%, , cost of 6.5mm m.s. coil, , fabr

CTN :39740288

08 Apr, 2025 34.15 Lacs

Delhi - Delhi

Tender For supply of consume - dept of ctvs surg, human thrombin gelatin matrix 5ml (floseal), aortic punch 3mm, aortic punch 3.5mm, non absorbable temporary pacemaker electrode fep-13e,17mm,/1/2c, taper cut ,v-58,60mm straight reserve cutting ,ks breakway/auto-cassablepoint (box of 12), surgical sealant - synthetic polyethylene glycols(pegs), na dilute hydrogen chloride solution(hci) and a sodium phosphate/sodium carbonate solution -4ml, iodine impregnated transparent incise drape large (ioban ),60x45 cm, snugger set paediatric, snugger sets adult, snugger set neonatal, non absorbable temporary pacemaker electrode fep 15e 26mm needle 1/2c, taper cut, v-7,60mm straight reverse cutting , ks breakway / auto-cassable point

Sodium Carbonate Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

State Government

corporations/Associations/Others

State Government

State Government