Latest sodium carbonate Tenders | Government sodium carbonate Tenders

CTN :39835124

16 Apr, 2025 NA

Imphal - Manipur

Tender For supply of drugs and medicine - hydroxyethyl starch , adenosine , adrenaline , amikacin 250 mg , amikacin 375 mg , amikacin 500 mg , amikacin100 mg , amiodarone , amoxicillin , amoxicillin 250 mg and clavulanic acid 50 mg inj , amoxicillin 500 mg and clavulanic acid 125 mg tab , antacid gel , atracurium besylate , atropine , azithromycin 500 mg tab , betadine mouth gargle , bicarbonate solutions , botropase , bupivacaine , butorphenol , calcium gluconate , cefoperazone sulbactam , cefotaxime 125 mg , cefotaxime 250 mg , ceftriaxone 1 gm , ceftriaxone 125 mg , ceftriaxone 250 mg , ceftriaxone 500 mg , ceftriaxone with sulbactum 1.5 gm , ceftriaxone with sulbactum 375 mg , ceftriaxone with sulbactum 750 mg , chlorhexedine gluconate soln , cis-atracurium , desflurane , dexamethasone , dexmedetomidine , dextrose 10 percent 500 ml iv inj , dextrose 25 percent 100 ml iv inj , dextrose 5 percent 500 ml iv inj , dextrose 5 percent and sodium chloride 0.9 percent 500 ml iv inj , diclofenac aq , dobutamine , dopamine , doxophylline , eldex p , enoxaparin 40mg , enoxaparin 60mg , esmolol , etophylline and theophylline , fentanyl citrate , frusemide , glutaraldehyde neutralyser , glutaraldehyde solution , glycopyrrolate neostigmine methylsulphate , glycopyrrolate , hand sanitizer , heloperidol , heparin , human normal albumin , hydrocortisone , hydrogen peroxide 30 percent , hydrogen peroxide 6 percent , sugammadex , isoprenaline , ketamine , labetalol , levofloxacin , lignocaine 2 percent 30 ml , lignocaine 2 percent jelly , lignocaine 2 percent with adrenaline , lignocaine 4 percent 30 ml , lignocaine hydrochloride 2 percent , lorazepam 2 ml inj , mvi inj , magnesium sulphate , mannitol 20 percent 100 ml , mephentermine , meropenem 1 gm , meropenem 250 mg , meropenem 500 mg , methylprednisolone acetate , metoclopramide , metronidazole , midazolam , morphine tab , morphine inj , mupirocine ointment , naloxone , neostigmine , neutral detergent , nitroglycerin , nor adrenaline , ofloxacin and ornidazole , octreotide , ondansetron , oral rehydration salt , oxytocine , pantoprazole tab , pantoprazole inj , paracetamol inj , paracetamol 500 , paracetamol 650 , paracetamol iv inj , pentazocine , pethidine , pheniramine maleate , phenobarbidone , phenytoin sodium , piperacillin and tazobactum 1.125 gm inj , piperacillin and tazobactum 2.250 gm inj , piperacillin and tazobactum 4.5 gm inj , potassium chloride , povidone iodine 10 percent solution 500 ml , povidone iodine 5 percent solution 500 ml , povidone iodine ointment , prilox cream , promethazine 2 ml , propofol 1 percent 20 ml inj , rl iv inj , rabies vaccine human , ranitidine , rectified spirit , rocuronium bromide , ropivacaine , sevoflurane , snake venom antiserum , sodium bicarbonate , sodium chloride 100 ml iv inj , sodium chloride 1000 ml iv inj , sodium chloride 500 ml iv inj , sodium chloride 3 percent 100 ml iv inj , sodium hypochlorite , succinylcholine chloride , teicoplanin , tetanus toxoid , tinidazole , tpn solution , tramadol , tranexa inj , tranexamic acid tab , tuberculin purified protein derivative , vancomycin , vecuronium bromide , vitamin k , water for injection

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government/Public Sector

CTN :39846599

16 Apr, 2025 NA

East Singhbhum - Jharkhand

Tender For supply of mg domperidone 30 mg. cap or tab. , pantaprazole 40 mg . tab. , rabiprazole 20 mg domperidone 30 mg. tab. , omeprazole 20 mg. cap , ondansetron 4 mg. tab. , calcium 500 mg. tab. , allopurinol 100 mg. tab. , febuxostat 40 mg. tab. , betahistine 8 mg. tab. , albendazole 400 mg. tab , i. v. sodium chloride 0.9 percent 500 ml , i.v. mannitol 20 percent 100ml , levolin respules 0.31 mg , budecort respules 0.5 mg , olmesartan 40mg. tablet , teneligliptin 20mg. tablet , ors 21.8gms. , i.v sodium chloride 0.9 percent 100ml. , diclofenac 50mg tablet , paracetamol 650mg tablet , dexamethasone sodium phosphate 4mg. injection 2ml. , promethazine hydrochloride 25mg injection 2ml. , lignocaine hydrochloride 2 percent injection 30ml. , lignocaine hydrochloride and adrenaline bitartrate injection 30ml. , metoclopramide hydrochloride 5mg. injection 2ml. , phenytoin sodium 50mg. injection 2ml. , dopamin hydrochloride 40mg injection 5ml. , etofylline and theophylline injection 2ml. , frusemide 10mg injection 4ml. , diphenhydramine hcl ammonium chloride sodium citrate and menthol syrup 100 ml cough syrup , paracetamol 125 mg tab , i.v dextrose 25 percent 100 ml , drotaverine hychloride 40 mg injection , ondansetron 2 mg injection , hyoscine butylbromide 20 mg injection , pantoprazole 40 mg injection , cefuroxime 500 mg tab , paracetamol injection , diazepam injection , pentazocine injection , etophylline and theophylline 150mg tablet , etophylline and theophylline 300mg tablet , hydrocortisone sodium 100 mg injection , adrenaline bitartrate injection , atropine sulphate injection , dapagliflozin 10mg , tetanus toxide 0.5 ml injection , lignocaine 2 percent jelly 30 gms , i.v electrolyte p 500 ml

CTN :39846918

17 Apr, 2025 14.57 Lacs

Belgaum - Karnataka

Tender For supply of frusemide 40 mg amiloride hydrochloride 5 mg tab , pancreatic enzyme supplement lipase content of 25000 units cap , antispasmodic containing mefenamic acid 250 mg dicyclomine hcl 10 mg , tab levosulpiride 25 mg , tab entacavir 0 point 5 mg , antacid chewable aioh 3 300mg mg silicate 25 mg simethicone 25 mg , trypsin and chymotrypsin 6 ratio 1 100000 au enteric coated tab , ranitidine hcl 50 mg 2 ml inj , metoclopramide 10 mg tab , metoclopramide hcl 5mg ml 2ml inj , dicyclomine 20 mg paracetamol 500 mg tab , dicyclomine hcl 20mg inj , drotaverine hcl 20 mg per ml inj , hyoscine bromide inj 20 mg per ml 1ml inj , mebeverine hcl 135mg tab , isapgol ispaghula husk 3 point 5 gm , bisacodyl 5 mg tab , parraffin liq in bottle of 100 ml , pancreatic enzyme cap lipase content of 10000 to 20000 units , loperamide 2mg tab , pantoprazole 40 mg domperidone sr 30 mg cap , pantoprazole 40 mg levosulpride 75 mg cap , rifaximine 400 mg tab , ethinyl estradiol 0 point 035mg cyproterone acetate 2mg pack of 21 tablets , oestrogen cream concentration 0 point 06 percent to 0 point 1 percent tube of 15 to 50 gms , clotrimazole vaginal pessary 100mg , levonorgestrel 0 point 25 mg ethinylestradiol 0 point 03mg pack of 21 tab , nor ethisterone 5mg tab , gliclazide mr 30 mg tab , glipizide 5mg tab , glibenclamide 5mg tab , sitagliptin 50 mg metformin 1000mg tab , linagliptin 2 point 5 mg metformin 500 mg , pioglitazone hydrochloride 15 mg tab , carbimazole 5 mg tab , alendronate sodium 70mg tab , pyridostigmine 60 mg tab , calcium acetate 500 mg tab , protein supplement for predialysis renal failure , sevelamer 400 mg tab , betaxolol eye drops 0 point 25 percent 0 point 5 percent bott of 5 ml , chloramphenicol 0 point 5 percent dexamethasone sodium 0 point 1 percent bott of 5 ml , ciprofloxacin hcl 0 point 3 percent dexamethasone 0 point 1 percent bott of 5ml , gatifloxacin 0 point 3 percent eye drop bott of 5 ml , gentamicin sulphate 0 point 3 percent gentamicin base with hydrocortisone acetate ip 1 percent eye ear drops bott of 5 ml , ketorolac tromethamine 0 point 4 percent eye drops , brimonidine tartrate 0 point 2 percent eye drops , methyl cellullose 2 percent solution bottle of 5 ml , ofloxacin 0 point 3 percent bott of 5 ml , luliconazole cream , timolol maleate eye drop 0 point 5 percent bott of 5 ml , tobramycin 0 point 3 percent bott of 5 ml , e d moxifloxacin dexamethasone , brimonidine 0 point 2 percent timolol 0 point 5 percent eye drops , latanoprost 0 point 005 percent w per v eye drops , beclomethasone dipropionate nasal spray 50 mcg per dose metered dose 150 units , mometasone nasal spray , fluticasone furoate 27 point 5 mcg nasal spray , betahistine dihydro chloride 8mg tab , cinnarzine 25 mg tab , clotrimazole 1 percent w per v ip lignocaine 2 percent w per v ip ear drop bott of 10ml , chloramphenicol 5 percent clotrimazole 1 percent betamethasone 0 point 25 percent lignocaine hcl 2 percent in bott of 5 ml , nasal decongestant adult drops xylometazoline hcl 0 per 1 percent nasal drop bottle of 10 ml , xylometazoline hcl 0 point 05 percent nasal solution for paed use bott of 10ml , cyproheptadine hcl 2 mg per 5ml bott of 100 ml , domperidone syp 1 mg per ml bott of 30 ml , norfloxacin syp 100mg per 5ml bott of 30 ml , ondansetron syp 2 mg per 5ml in bott of 30 ml , levo salbutamol syrup 1 mg per 5ml bottle of 100 ml , alprazolam 0 point 25 mg tab adapalene 0 point 1 percent tube of 15 gm, tacrolimus oint , benzoyl peroxide , calamine lotion 50 ml tube, bid details/ 2 / 83

Central Government/Public Sector

CTN :39848740

30 Apr, 2025 NA

Delhi - Delhi

Tender For supply of 2025-26 (ami no. 30.24) iv solution ringer lactate containing sodium hydroxide 0.32gm, sodium chloride 0.50gm, potassium chloride 40mg, calcium chloride mg, 500ml bottle

Central Government/Public Sector

CTN :39541968

29 Mar, 2025 6.00 Lacs

Bhopal - Madhya Pradesh

Tender For bid to ras supply of chemicals for soil analysis - ammonium molybdate tetrahydrate , orthophosphoric acid abt , sulfuric acid , activated charcoal , buffer capsule ph 4.0 colour of solution orange , buffer capsule, ph 7.0 colour of solution green , buffer capsule, ph 9.2 colour of solution blue , devarda alloy , edta calcium disodium salt , antimony potassium tartrate trihydrate , hydrogen peroxide , methyl red indicator solution , oxalic acid dihydrate , sodium acetate trihydrate , potassium hydroxide pellets , sodium bicarbonate , potassium dichromate , methanol , ammonium fluoride , ammonium chloride , nitric acid 69 72 perc pure , ferrous ammonium sulphate hexahydrate , ammonium acetate , nitric acid , perchloric acid , hydrofluoric acid , phenolphthalein indicator , diethylene triamine penta acetic acid dtpa , ethelynediamine tetra acetic acid , devardas alloy , fluorescein diacetate , potassium dihydrogen phosphate , triphenyl tetrazolium chloride ttc , 1 3 5 triphenyltetrazolium formazan , sodium bi carbonate , sodium chloride , potassium sodium tartrate tetrahydrate also known as rochelle salt , hydrochloric acid , calcium chloride , sodium thiosulphate , acetic acid , activated charcoal phosphorus free , ammonium metavanadate , ammonium molybdate , barium chloride , boric acid , calcon indicator , copper sulphate , ebt indicator , ferrous ammonium sulphate , gum accasia , l ascorbic acid , murexide , orthophosphoric acid , potassium permanganate , potassium sulphate , selenium metal powder , sodium hexa meta phosphate , sodium hydroxide pellets , sodium acetate , ammonium hydrogen carbonate , maleic acid , citric acid , oxalic acid , potassium dihydrogen orthophosphate anhydrous , methyl orange indicator , methyl red indicator , malic acid , gum acacia powder , guar gum powder , potassium dicromate , potassium cloride , ammonium metavandate , concentrated sulfuric acid , orthoposphoric acid , ferrous ammonium sulphote , potossium permangnate , sodium hydroxide , methyl red , bromocresol green , azomethine , standard hydrochloric acid , sodium bicorbonate , dargo g 60 activate charcol , ammonium paramolybdate , antimony potassium tartrate , ascorbic acid , potassium dihydrogen orthophocphate , calcium cloride , magnesium cloride , potassium nitrate , gum acacia , dtpa diethylenetriamine penta acitic acid , tea triethonol amine , buffer tablet ph 4.0 7.0 9.2 , microplate , ethanol

Central Government/Public Sector

CTN :39562351

07 Apr, 2025 NA

Roorkee - Uttarakhand

Tender For corrigendum : supply of various chemicals-, mercuric sphate , silver sulphate (ag/504) (258) , ammonium chloride (nh) (500g) , magnesium sulfate (mgso) (500g) , calcium chloride (cac) (500g) , nesslers reagent (100m) , potassium persulfate (,50%) (500g) , ammonium molybdate (100g) , stannus chloride (snc12) (100g) , glycerol (500m , calcium carbonate (caco) (500g) , cobalt chloride cocl2 (100g) , zinc chloride zn2(500) , nickel chiaride nic12 (500g) , manganese sulphate ms04 (500g) , sodium selenite na2seo3-5h20(25) , sodium tungstate dihydrate na2wo4-2h20(100g) , sulfanlic acid (5g) , n-(2-naphthyl)-ethylenediamine dihydrochloride (ned) (5) , hydrochloric acid (500 ml) , nitric acid (500 ml) , sulphuric acid (2.5l) , anthrone (100 , standard glucose (500g) , copper sulphate tetrahydrate (500g) , potassium hydrogen tartarate (500g) , na (500g) , cod call test (range 100-1500mg/(25/pack) , reagent bottle screw cap 500ml , hplc vail 2 ml transparent (paket of 1001 , hplc vail 2 ml amber colour (pallet of 1001 , silica crucilbel (25 ml) , beaker (100m) , reagent bottle (100 ml) , chemical weighing bottle (25-50 ml) , quartz cuvette , carboy (101) , glass slides (pack of 50) , cover slips (pack of 100) , membrane filter nylon (0.45m) (pack of 1001 , silicone rubber septum seals gl 45 (pack of 100),

CTN :39804397

31 Mar, 2025 NA

Ponnani - Kerala

Tender For supply of lab reagents - name of reagent/consumables with equipments, albumin for bs390, alkaline phosphatase for bs390, alkaline wash solution for bs390, aso for bs390, bilirubin total for bs390, bilirubin direct for bs390, calcium for bs390, cholesterol for bs390, crp for bs390, creatinine for bs390, hdl cholesterol for bs390, glucose hexokinase for bs390, ldl cholesterol for bs390, multicalibrator for bs390, phosphorus for bs390, ra for bs390, sgot for bs390, sgpt for bs390, total protein for bs390, triglycerides, urea uv for bs390, uric acid for bs390, qc norm for bs390, qcc path for bs390, crp for mispai2 ( 30 t), aso for mispai2 ( 30 t), ra for mispai2 (30 t), hbaic for mispai2 (15 t), capillary tube ( 100 nos), sodium conditioner for innolyte plus, weekly cleaning solution for innolyte plus, glucose for merilyser ( 1 ml), urea for merilyser ( 1 ml), creatinine for merilyser (1ml), sgpt for merilyser(1ml), cholesterol for merilyser(1ml), clot activator non vacum, vacutainer needle 22 g, k3 edta tube vacum, clot activator vacum, diluent for pe 6000(20 l), rinse/cleaner for pe 6000 (10l), lyse for pe 6000 (500ml), e-z cleaner for pe 6000 (100ml), probe cleaner for pe 6000(50 ml ), esr pipette for vesmatic 20, bilirubin total for merylyser(1 ml), bilirubin direct for merylyser (1ml), qc level 1 for mindray 900i, qc level 2 for mindray 900i, qc level 3 for mindray 900i, 3.8 % sodium citrate tube( vacum), dpx (250 ml), hitachi cup, anti a (10ml), anti ab (10ml), anti a1 h lectin (5ml), anti b (10 ml), anti d(10ml), anti d igg&igm(10ml), ahg(5ml), ayres spatula, barium chloride, bbr graph lab line, bbr pen lab line, capillary tube, clot activator tube, cover slip 18*18 mm( 1no), cover slip 22*22 mm(1no), cover slip 22*40 mm(1no), dengue igg,igm&ns1 combo card test, diamond pencil, disttiled water(5l), ea 36 (125 ml), esr pipette disposible, filter paper, filter paper sheet(ordinary), fouchets reagent, harris haematoxyline stain(500ml), hav igm card test, hcv card test, giemsa stain (125 ml), malaria pan pv pf, widal card test (double barrel whole blood), streptococcal rapid antigen (card test), 100 %isopropyl alcohol(5l), k3 edta tube non vacum, lancet, liss (250 ml), lepto igm card test, microtip large, micro tip small, micro scopic slide, micro centrifuge tube(500 nos), matrix gel card(144 t), og 6 (125 ml), peadiatric k 3 edta tube, pregnancy card, urine strip multiparameter, 3.8 % sodium citrate tube( non vacum), sodium flouride tube ( non vacum), sodium nitro prusside, sodium hypochlorate (2% 5l), sterile swab, sulphur powder, sulpho salycilic acid, spot band aid, tissue roll, test tube plastic (12*75), test tube glass ( 12*75), test tube brush, tourniquet belt, thermal paper (55 mm), urine container sterile, urine container non sterile, screw capped bottile, urine strip glucose protein, urine strip glucose ketone, viral transport medium ( vtm ), xylene ( 500 ml), vdrl card test, widal slide test (20ml), aso latex, ra latex, crp latex, hematology qc(bc5130), hbsag 0.3 ng sensitivity card test

State Government

CTN :39200933

07 Apr, 2025 5.48 Lacs

Kutch - Gujarat

Tender For corrigendum : supply of fine chemical reagents & laboratory items for chemical laboratory at gsecl kltps - store code: 5910010029 1-amino 2-napthol 4-sulphonic acid, store code: 5931550041 ammonium molybdate ar ranbaxy, store code: 5931320001 barium chloride, store code: 5931330001 barium hydroxide lr, store code: 5915000002 barium sulphate, store code: 5934060001 benzyl alcohol, store code: 5916980008 bromothymol blue (ph 6.0-7.6), store code: 5930840001 calcium acetate ar, store code: 5916980014 erechrom black-t (solochrome black-t), store code: 5915760001 edta disodium salt ar/gr, store code: 5916600001 glycerol glaxo ar, store code: 5915980023 hydroxile amine hydrochloride, store code: 5915980025 indigo carmine, store code: 5933540001 oxalic acid ar, store code: 5916610003 methanol, store code: 5917200005 tarteric acid ar 500gms pkg, store code: 5932050001 methyl orange powder, store code: 5932050002 methyl red powder, store code: 5930890006 mercuric chloride, store code: 5930870003 magnesium chloride, store code: 5920200080 neda(1-napthyl ethylenediamine dihydrochloride), store code: 5950000017 nessler reagent, store code: 5934040003 iso-propal alchohol 2.50 ltrs. pack., store code: 5910051021 o tolidine reagent for chlorine testing 500 mls pack., store code: 5915980032 phenolphthalein powder, store code: 5930850027 potasium chloride 500 gram/bottle, store code: 5930850008 potassium cromate, store code: 5930850010 potassium di-hydrogen ortho-phosphate, store code: 5930850016 potassium iodate, store code: 5930850014 potassium hydroxide (pallets), store code: 5930850021 potassium permanganate powder, store code: 5930850023 potassium thiocynate, store code: 5930100002 silver nitrate, store code: 5910100001 sodium bi-carbonate, store code: 5910090005 sodium carbonate, store code: 5915350023 sodium hydroxide (pallets), store code: 5915350024 sodium meta bisulphite, store code: 5915350033 sodium thiosulphate, store code: 5930900002 stannous chloride, store code: 5932500002 starch, store code: 5915980035 sulphanil amide, store code: 5955030001 universal ph indicator solution 500 ml pack., store code: 5930120001 copper sulphate, store code: 5915350005 n/10 sodium thiosulphate ampouls, store code: 5945030001 pvc narrow mouth reagent bottle 1000 ml, store code: 5945030003 pvc narrow mouth reagent bottle 500 ml, store code: 5945030005 pvc wash bottle 500 ml, store code: 5945030006 pvc wide mouth reagent bottle 1000 ml, store code: 5945030008 pvc wide mouth reagent bottle 500 ml, store code: 5945600004 pvc buckets-15ltr

CTN :39793600

28 Mar, 2025 10.00 Lacs

Dindigul - Tamil Nadu

Tender For suppling of public health material in sriramapuram town panchayat - bleaching powder (for water supply) isi grade 33% chlorin 1065 grade no.2, bleaching powder (for public health) isi grade 22% chlorin 1065 grade no.2, black phenoyl, abate 50% ec, hydrated lime powder, pyrethrum 2% extract, baytex 1000, fogg m/c. lpg cylinder, emi solution, organic jaggery (naatu vellam), fenthion 82.5% e.c, tempephos 50% ec, round up / glyphosate ( kalai kolli ), 2-4d oil, alum(sulphate of aluminium ferric), malathion, acid, bio larvicide, bt powder, non ferric acid, lysol, alcohol hand sanitizer, sodium hypo chloride, mask, n95 mask, gloves, a. 12" gloves, b. 18" gloves, c. oneside rubber coated gloves, d. surgical gloves, e. cotton gloves, mask, a.n95 mask, b. three layer, c. cotton mask, ppe kit, e.b gloves, cap, helmet, overcoat, foot boot, rain coat, reflector coat (green/orange), sweeper s coat (green) with sleeve, 50 litre can pull cart, 80 litre can pull cart, broom stick with handle, broom stick (thudaippam), crowbar (kadaparai), shovel with handle, forque with handle, pickaxe with handle, slump cleaner with handle ss(gi plate ), fiber ghamela small, fiber ghamela big, bamboo ghamela small, bamboo ghamela big, pull / push cart (two wheeler), pull / push cart (four wheeler), pull/push cart wheel tube, pull/push cart tyre, machete with handle (aaruval) big, machete (kaarukaruval) small, 3 mamooty with handle (kotthu), 6 mamooty with handle (kotthu), mamooty with handle, power sprayer heavy (fuel operated), power sprayer heavy (battery operated), g i bucket ( rice mill ), slump cleaner with handle ( agappai ), wooden handle for mamooty, pickaxe, kundalam, iron ghamela, pump stick miller with handle, 12 g i bucket, plastic mug, road cleaning brush, aluminium ghamela ( annakudai ), 200 litre can pull cart, action m l o, kundalam, bamboo ghamela (thattukoodai), calcium hpo choride soultion, hand wash liquid, covid 19 - bio medical waste yellow bag, hand gloves ( cotton , synthetic mixed), hand gloves ( synthetic ), one time use hand gloves, face shield safety & use, face mask ffp 1, medical infrared fore head thermometer, pulse oximeter, white phenyl, toilet cleaner thick liquid, lemon grace flavour soap oil, lemon grass oil, room fresher - perfume, full face chimical proofed gas mask (with filter), nitrile rubber hand gloves, pollution safety mouth, chappal (ladies & gents), safety nylon cap, raxin cap, sprayres ( 12 liters capacity), sprayres ( 16 liters capacity), coconut bamboo milar, canal spoon grip ( kongani), small fork with fork handle ( ), 50 ltrngarbage bin, garbage disposal plate ( ), sickle (small), bretex - for larve control, 5 lit bucket (plastic), , ( ), bleaching water, soap oil, reponsar (beta cyfluthrin 2.45 sc flying insect killer), ammonium sulphate, king fogg - high fogg ( delta methrin 1.25 ulv), reflector jacket, mamooty with handle, forque with handle, pickacc with handle, tata shovel with handle, crown bar, drainage mamooty with handle, fibre gamalish, bamboo gamalish - big, glouse, foot boot, cart type, cart tube, over coat, 50 litres can, broom stick, mask, 10" gi bucket, 12" gi bucket, gi mug, brush, bill hook, grass cutter with handle, coco broom stick with bamboo handle, 3" mamooty with handle (koththu), 6" mamooty with handle (koththu), kundalam, fibre ghamela - big, fibre ghamela - small, bamboo gamalish - small, iron ghamela, aluminium ghamela (annakudai), pull / push cart (two wheeler), pull / push cart (four wheeler), 200 litre can pull cart, machete with handle (aruval) -big, machete with handle (aruval) -small, slum cleaner with handle (gi plate), slum cleaner with handle (agappai), pump stick miller with handle, wooden handle for mamooty, pickace, kundalam, action m l o, helmet, cart tyre ( pull / push cart tyre), cart tyre ( pull / push cart wheel tube), 80 litres can pull cart, road cleaning brush, bamboo with handle, reflective jocket, bell, rice mill g.j bucket, bamboo plate, plastic bucke

Sodium Carbonate Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

State Government