Latest styrene Tenders | Government styrene Tenders

CTN :39720952

29 Mar, 2025 15.00 Lacs

Kapasan - Rajasthan

Tender For corrigendum : work of road furniture as per requirement in municipal area kapasan. (annual contract) - providing and laying marking of center line and stop line etc with hot thermoplastic compound 2.5 mm thick on road/ plain surface, including reflectorising glass beads @ 250 gms per sqm area with special applicator machine, as per irc:35 including cleaning the surface of all dirt, dust and other foreign matter, demarcation at site and traffic control involved. the finished surface to be level, uniform and free from streaks and holes as per clause 803 of mort&h specification including all material, labour, machinery, lighting, guarding and maintenance of diversion., providing and fixing of retro- reflectorised cautionary, mandatory and informatory sign as per irc :67 made of encapsulated lens type reflective sheeting vide clause 801.3, fixed over aluminium sheeting, 1.5 mm thick supported on a mild steel angle iron post 3 metre long and size 75 mm x 75 mm x 6 mm firmly fixed to the ground by means of properly designed foundation with m15 grade cement concrete 45 cm x 45 cm x 60 cm, 60 cm below ground level as per approved drawing including all material, labour., 60 cm equilateral triangle, 80 mm x 60 mm rectangular, 60 cm x 45 cm rectangular, providing and erecting direction and place identification retro-reflectorised sign as per irc:67 made of encapsulated lens type reflective sheeting vide clause 801.3, fixed over aluminium sheeting, 2 mm thick framed to angle iron 40x40x5mm with area not exceeding 0.9 sqm supported on a mild steel single angle iron post 75 x 75 x 6 mm firmly fixed to the ground by means of properly designed foundation with m15 grade cement concrete 45 x 45 x 60 cm, 60 cm below ground level as per approved drawing including all material, labour., providing and erecting direction and place identification retro- reflectorised sign as per irc :67 made of encapsulated lens type reflective sheeting vide clause 801.3, fixed over aluminium sheeting 2 mm thick framed to angle iron 40x40x5mm with area exceeding 0.9 sqm supported on two nos mild steel angle iron post 75 mm x 75 mm x 6 mm, firmly fixed to the ground by means of properly designed foundation with m 15 grade cement concrete45 cm x 45 cm x 60 cm, 60 cm below ground level as per approved drawing including all material, labour., supplying and fixing glow studs of size 100 x 20 mm made of heavy duty body shall be moulded asa (acrylic styrene acrylortrite) of abs having electronically welded micro prismatic lens with abrasion resistant coating as approved by engineer- in-charge. the glow stud shall support a load of 13635 kg. tested in accordance with astm d4280. the slope of retro-reflective surface shall be 35+/ -5 degree to base. the panels on both sides with at least 12 cm of reflective areas up each side. the luminance intensity should be as per the specification and shall be tested as described in astm 1: 809 as recommended in bs : 873 part 4 : 1973 as per approved sample & manufactures by the engineer-in-charge., providing and fixing l type bollard 135cm height made out of 1.25mm thick m.s. sheet welded in conical section having upper dia 15cm and lower dia 20cm with another attachment of 150x150x7mm thick plate and hold fast at bottom, whole body is painted in white stove enamel and red reflective 3 band, each of 7.5cm and one reflective sheet of 15cm dia provided to it complete in all respect including all material, labour, diversion., providing and fixing swiss type hazard marker made out of 2mm thick m.s. sheet size of box is 15x15cm with hold fast at bottom whole body is painted in white stoving enamel paint with white/ high intensity grade prismatic type sheeting on all four side complete in all respect including all material, labour, and diversion., solar raised pavement markerssupply & installation of solar raised pavement markers made of polycarbonate molded body with circular shape, solar powered, led self illumination in active m

Central Government/Public Sector

CTN :39848740

30 Apr, 2025 NA

Delhi - Delhi

Tender For supply of 2025-26 (ami no. 30.24) iv solution ringer lactate containing sodium hydroxide 0.32gm, sodium chloride 0.50gm, potassium chloride 40mg, calcium chloride mg, 500ml bottle

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

corporations/Associations/Others

CTN :39835334

16 Apr, 2025 6.00 Lacs

Faridabad - Haryana

Tender For supply of phenolphathalein , o toludine , malachite green , sodium perborate tetrahydrate , glacial acetic acid , distilled water , benzidine hydrochloride sol , 3 aminophthal hydrazide , sodium hydroxide flakes , pyridine , dextrose , sodium chloride , 12 panel drub abuse kit , grams iodine , potassium iodide , picric acid , sodium alpha naphthyl phosphate , fastblue salt , potassium dichromate , sulphuric acid , dragondorfs reagent , nesslers reagent , schiffs reagent , sodium nitroprusside , acetone , mercurous nitrate , vanillin reagent , formaldehyde , furfuraldehyde , cobalt thiocyante , 4 dimethylamino benzaldehyde , nitric acid fuming , ferrous sulphate , sodium picrate , 3355 tetrabromophenolphthalein ethyl ester , ferric chloride , folin and ciocalteus phenol reagent , millons reagent , p dimethylaminobenzaldehyde , portable breath alcohol analyzer

CTN :39482582

08 Apr, 2025 NA

Srinagar - Jammu And Kashmir

Tender For corrigendum : supply of various reagents, at skims, soura, srinagar on one year rate contract basis. - media, agarose (low eeo), dna ladder (100 bp), dna ladder (50 bp), dna zap, rnase zap, dntps, gel loading buffer dye, glycerol (mol. biology), isoamyl alcohol (mol. biology), isopropanol (mol. biology), lysozyme (powdered), magnesium chloride (25mm), potassium acetate 3m (ph 5.2), primers, proteinase k, sodium acetate 3m (ph 5.2), sodium hydroxide (mol. biology), tae buffer (50x), te buffer, tris borate edta buffer (50x), anti a, anti b, anti ab, anti d (monoclonal), anti d (polyclonal), anti a1 (lectium), ahg coombs, anti h, bovines albumin, papain, anti c, anti c, anti e, anti e, hb prostrip, taq dna polymerase, hla positive control, hla negative control, rabbit complement lyophilized, heparin salt, density gradient sol. 10.77g/dl, dnase, mgcl2 solution (25mm), diluent, lyse, probe cleanser, glucose reagent (god pod), uristix 2 parameter, uristix 10 parameter, fetal bovine serum (fbs), pha m, trypsin (lyophilized), 25 bp ladder, sybr green, dmem media, eco 321, hinfi, mbo i, ddeli, ecor v, di-george probe (22q del), wolf-hirschhorn region probe, williams region probe, ip deletion probe, angelmann, praderwilli probe, kallman region probe, cri-du-chat region probe, snrpn region probe, fish implementation kits, probe for her 2, probe for alk, aneuploidy probes (trisomy 13), aneuploidy probes (trisomy 18), aneuploidy probes (trisomy 21), rpmi 1640 lyophilised with l-glutamine & phenol red indicator., heparin, oct (optimal cutting temperature embedding medium), oil red o , orange g (powder), microscopic immersion oil (cedar wood oil), mineral oil, pylocarpin, safranin, sodium hydroxide pellets mw 40, temed, triton x 100, trizol, trypsin 2.5% (tissue culture grade), turks fluid, tween 20, tween 80, wax (congealing point 600c), zinc dust (nitrate free), light green (powder), pilocarpire nitrate reagent, rpmi media

Central Government/Public Sector

CTN :39541968

29 Mar, 2025 6.00 Lacs

Bhopal - Madhya Pradesh

Tender For bid to ras supply of chemicals for soil analysis - ammonium molybdate tetrahydrate , orthophosphoric acid abt , sulfuric acid , activated charcoal , buffer capsule ph 4.0 colour of solution orange , buffer capsule, ph 7.0 colour of solution green , buffer capsule, ph 9.2 colour of solution blue , devarda alloy , edta calcium disodium salt , antimony potassium tartrate trihydrate , hydrogen peroxide , methyl red indicator solution , oxalic acid dihydrate , sodium acetate trihydrate , potassium hydroxide pellets , sodium bicarbonate , potassium dichromate , methanol , ammonium fluoride , ammonium chloride , nitric acid 69 72 perc pure , ferrous ammonium sulphate hexahydrate , ammonium acetate , nitric acid , perchloric acid , hydrofluoric acid , phenolphthalein indicator , diethylene triamine penta acetic acid dtpa , ethelynediamine tetra acetic acid , devardas alloy , fluorescein diacetate , potassium dihydrogen phosphate , triphenyl tetrazolium chloride ttc , 1 3 5 triphenyltetrazolium formazan , sodium bi carbonate , sodium chloride , potassium sodium tartrate tetrahydrate also known as rochelle salt , hydrochloric acid , calcium chloride , sodium thiosulphate , acetic acid , activated charcoal phosphorus free , ammonium metavanadate , ammonium molybdate , barium chloride , boric acid , calcon indicator , copper sulphate , ebt indicator , ferrous ammonium sulphate , gum accasia , l ascorbic acid , murexide , orthophosphoric acid , potassium permanganate , potassium sulphate , selenium metal powder , sodium hexa meta phosphate , sodium hydroxide pellets , sodium acetate , ammonium hydrogen carbonate , maleic acid , citric acid , oxalic acid , potassium dihydrogen orthophosphate anhydrous , methyl orange indicator , methyl red indicator , malic acid , gum acacia powder , guar gum powder , potassium dicromate , potassium cloride , ammonium metavandate , concentrated sulfuric acid , orthoposphoric acid , ferrous ammonium sulphote , potossium permangnate , sodium hydroxide , methyl red , bromocresol green , azomethine , standard hydrochloric acid , sodium bicorbonate , dargo g 60 activate charcol , ammonium paramolybdate , antimony potassium tartrate , ascorbic acid , potassium dihydrogen orthophocphate , calcium cloride , magnesium cloride , potassium nitrate , gum acacia , dtpa diethylenetriamine penta acitic acid , tea triethonol amine , buffer tablet ph 4.0 7.0 9.2 , microplate , ethanol

State Government

CTN :39200933

07 Apr, 2025 5.48 Lacs

Kutch - Gujarat

Tender For corrigendum : supply of fine chemical reagents & laboratory items for chemical laboratory at gsecl kltps - store code: 5910010029 1-amino 2-napthol 4-sulphonic acid, store code: 5931550041 ammonium molybdate ar ranbaxy, store code: 5931320001 barium chloride, store code: 5931330001 barium hydroxide lr, store code: 5915000002 barium sulphate, store code: 5934060001 benzyl alcohol, store code: 5916980008 bromothymol blue (ph 6.0-7.6), store code: 5930840001 calcium acetate ar, store code: 5916980014 erechrom black-t (solochrome black-t), store code: 5915760001 edta disodium salt ar/gr, store code: 5916600001 glycerol glaxo ar, store code: 5915980023 hydroxile amine hydrochloride, store code: 5915980025 indigo carmine, store code: 5933540001 oxalic acid ar, store code: 5916610003 methanol, store code: 5917200005 tarteric acid ar 500gms pkg, store code: 5932050001 methyl orange powder, store code: 5932050002 methyl red powder, store code: 5930890006 mercuric chloride, store code: 5930870003 magnesium chloride, store code: 5920200080 neda(1-napthyl ethylenediamine dihydrochloride), store code: 5950000017 nessler reagent, store code: 5934040003 iso-propal alchohol 2.50 ltrs. pack., store code: 5910051021 o tolidine reagent for chlorine testing 500 mls pack., store code: 5915980032 phenolphthalein powder, store code: 5930850027 potasium chloride 500 gram/bottle, store code: 5930850008 potassium cromate, store code: 5930850010 potassium di-hydrogen ortho-phosphate, store code: 5930850016 potassium iodate, store code: 5930850014 potassium hydroxide (pallets), store code: 5930850021 potassium permanganate powder, store code: 5930850023 potassium thiocynate, store code: 5930100002 silver nitrate, store code: 5910100001 sodium bi-carbonate, store code: 5910090005 sodium carbonate, store code: 5915350023 sodium hydroxide (pallets), store code: 5915350024 sodium meta bisulphite, store code: 5915350033 sodium thiosulphate, store code: 5930900002 stannous chloride, store code: 5932500002 starch, store code: 5915980035 sulphanil amide, store code: 5955030001 universal ph indicator solution 500 ml pack., store code: 5930120001 copper sulphate, store code: 5915350005 n/10 sodium thiosulphate ampouls, store code: 5945030001 pvc narrow mouth reagent bottle 1000 ml, store code: 5945030003 pvc narrow mouth reagent bottle 500 ml, store code: 5945030005 pvc wash bottle 500 ml, store code: 5945030006 pvc wide mouth reagent bottle 1000 ml, store code: 5945030008 pvc wide mouth reagent bottle 500 ml, store code: 5945600004 pvc buckets-15ltr

Corporations And Associations And Others

CTN :38767761

04 Apr, 2025 NA

Hisar - Haryana

Tender For corrigendum : supply of consumables for hydro generation plant and zds chemical - supply of consumables for hydro generation plant and zds chemicals to rgtpp, khedar, hisar, potassium hydroxide flakes (lr grade) in 10kg packing, vanadium penta oxide (v205) (lr grade), palladium catalyst 0.5% (on alumina base) 3-5 mm spheres, buffer solution ph-4.0, buffer solution ph-7.0, buffer solution ph-9.2, karl fisher reagent (hydranal coulomat ag), toluene rectified, methanol extra pure, oxalic acid dehydrate, potassium hydroxide pellets, hydrogen peroxide, citric acid, acetone, universal indicator, chlorotex reagent, methanol dried, sodium bicarbonate, sodium molybedate dehydrate, isopropyl alcohol, bottle wash ldpe plastic 500 ml, sample bottle plastic 500 ml tarson or polycab, sample bottle plastic 250 ml tarson or polycab, sample bottle plastic 1000 ml tarson or polycab, whatman filter papers 4.7 cmcategory no. 1440-047grade-40 to test mi (1 pack= 1000 nos. filter circles), chloroform bellow 500 ml (to collect sample of flue gases), volatile matter determination cooking crucible with projection with lid, h-38mm, d-25mm, infusil 2010 & 2025, sodium hypochlorite 8-10%, is 11673, ferric chloride anhydrous, is 711, sodium meta bisulphite, is 248, antiscalant acidic 100%, hydrated lime used for ph adjustment in raw water and neutralization of waste water as per is: 1540 (part-ii)-1990 or with latest amendment thereof (grade-a)

Central Government/Public Sector

CTN :39562406

27 Mar, 2025 5.34 Crore

Paradip - Odisha

Tender For corrigendum : supply of "albendazole 200mg, 10 ml. bottle " , di-sodium hydrogen citrate 1.37g/5ml. pack of 100ml. , amoxicillin 200 mg,clavulanic acid-28.5 mg/5ml.bottle of 30ml , sucralfate1gm,oxetacaine 20mg/10ml. bottles of 170ml , aluminium hydroxide 200 mg,mg. hydroxide 200 mg. per 5ml sugar free liquid bottle packing of 170ml. , "dicyclomine 10mg./5ml. pack of 30ml " , "ambroxol 30mg,guaiphenesin 100 mg,terbutaline 2.5 mg/10ml syrup, bottles of 100ml. " , "dextromethorphan 10 mg ,phenylephrine 5 mg ,chlorpheniramine meleate 2mg/5ml syrup,bottles of 100ml. " , "azithromycin 200mg/5ml syrup/suspension ,bottles of 15ml. " , magnesium hydroxide 3.75 ml,liq. paraffin 1.25 ml, sodi. pico sulphate 3.33 mg bottles of 225ml. , "lactitol monohydrate 10 gm syrup/suspension pack of 200ml, " , "cetirizine 5 mg/5ml syrup/suspension bottles of 60ml." , "ondansetron 2 mg/5 ml syrup/suspension, bottles of 30ml. " , "paracetamol 250 mg/5 ml syrup/suspension, bottles of 60ml." , "montelukast 4mg, levocetrizin 2.5mg/5ml syrup/suspension bottles of 30ml." , "ambroxol 15 mg,guaifenesin 50 mg,terbutaline 1.25 mg 5ml syrup, bottles of 100-mlpadeiatric " , ofloxacin 100mg,metronidazole 200mg syrup, bottles of 60ml. , "ibuprofen 100mg,paracetamol 125mg/5ml syrup/suspension bottles of 30 ml" , "calamine and zinc oxide lotion... bottles of 100ml " , "beclomethasone dipropionate 0.025% w/w,phenylephrine hydrochloride 0.10% w/w,lignocaine hydrochloride 2.50% w/w,chlorocresol 0.1% w/w, pack of 20gm. " , povidone -iodine 2%w/v germicide gargle, pack of 100 ml bottle , chlorhexidine gluconate 0.2 %w/v mouth gargle , clotrimazole 1% w/w,beclomethasone 0.025% w/w (tube) pack of 15gm , "clindamycin 1% w/w,pack of 20gm " , "diclofenac 1.16, linseed oil -3,menthol 5,methyl salisylate 10,capsaicin 0.025...pack of 30 gm " , "diclofenac diethylammonium topical ,linseed oil topical... " , clobetasol 0.05%,miconazole 2%,tube of 15 gm packing , clobetasol 0.05%,salicylic acid 6%,tube of 30 gm packing , mometasone furoate 0.1% w/w (tube), pack of 15gm. , mometasone 0.1% w/w , fusidic acid 2% w/w (tube), pack of 10gm. , "triamcinolone acetonide 0.01 %w/w, pack of 5-10gm " , "ammonium chloride 0.5 %w/w,calcium lactate 0.5 %w/w,glycerin 3 %w/w,lactic acid 6 %w/w,magnesium chloride 0.3 %w/w,potassium chloride 0.5 %w/w,sodium chloride 0.5 %w/w,sodium dihydrogen phosphate 0.5 %w/w,urea 12 %w/w,ointment/cream " , "octinaxate,oxybenzone,zinc, avobenzone (spf 50) lotion pack of 50gm " , liquid paraffin 10.2 %w/w,white soft paraffin 13.2 %w/w gel/cream, pack of 100gm , "terbinafine 1% w/w powder, pack of 50-100gm " , "ketoconazole 2% w/w soap pack of 50-100gm " , ketoconazole shampoo 2% w/v pack of 60ml. , "itraconazole dusting powder 1% w/w, pack of 30-100gm " , luliconazole 1w cream/gel, pack of 50 gm , acyclovir 5% w/w cream, pack of 5gm , chloramphenicol 10 mg,polymycin b sulphate 10000 iu,dexamethasone 1 mg/1 gm ointment, pack of 5gm , "neomycin 3400 u,polymycin b 5000 u,bacitracin 400 u ointment, pack of 5-10gm " , chloramphenicol 10 mg,polymyxin-b 10,000 iu/1gm ointment, pack of 5gm , silver nitrate 0.2% w/w gel/cream (tube), pack of 10-30gm , silver nitrate 0.2% jar of 240 gms packing , ganciclovir 1.5mg/1gm w/w ophthalmic gel, pack of 5gm , "chlorhexidine 0.25%,metronidazole 1%/ gm gel, pack of 20-30gm " , "lignocaine 2% w/w gel (tube)with nozzle, pack of 30-60gm " , mupirocin 2% w/w ointment, pack of 5gm , "prilocaine 2.5% w/w,lidocaine 2.5% w/w oint. (tube), pack of 5gm to 30gm " , clotrimazole 1% w/v/ml lotion, pack of 15 ml , "clotrimazole 1% w/v,beclomethasone 0.025% w/v/ml lotion, pack of 15-30ml " , permethrin lotion 5% w/w, pack of 50-100ml , salbutamol 2.5mg./ml respule pack of 2.5 ml , salmeterol 25mcg,fluticasone 250mcg/puff , pack of 120 metered dose with dose counter. , formoterol fumarate 6mcg,budesonide 200mcg/puff, pack of 120 metered dose with dose counter. , formoterol fumarate 6mcg, budesonide 400mcg/puff, pack of 120 metered dose with dose count

CTN :39697186

29 Mar, 2025 NA

Multi City - Telangana

Tender For corrigendum : supply of etp chemicals and consumables-, antiscalent chemical for ro membrance (water palnt), antiscaling chemical with ph booster for 5mt boiler dosing, ink cartridges, makeup cartridges, cleaning solution, etp chemicals, hydrochloric acid (hcl), sulphuric acid, lr grade, 05 ltrs pack, k2cr207potassium dichromate er 500 gr pack, ferroin indicator, 100 ml pack, mercuric sulphate,250 gr pack, silver sulphate, 25 gr, petroleum ether,2.5 ltrs , sodium azide 100 gr , manganous sulphate 500 gr , manganoussulphatemonohydratesq 500g, ferric chloride250 gr , calciumchloride250 gr , hcl250 ml , starch500 gr , ferrous sulphate500 gr , whatman filter paper 40 no - 01 no's, whatman filter paper, 41 no-01 no's, normal filter paper 1mx1m- 02 no's (10 sheets), sodium hydroxide pellets250 gr , sodium iodide100 gr , sodium thiosulphate500 gr , kh2p04 (potassium dihydrogen o phosphate) 250 gr, na2hp04sodium phosphate monobasic anhydrous er 250 gr, buffer solution ph 4.0 , buffer solution ph 7.0 550ml , buffer solution ph 9.2 550ml , ferric alum, pac, dap , hypochlorite , urea

Styrene Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

corporations/Associations/Others

Central Government/Public Sector

State Government

Corporations And Associations And Others

Central Government/Public Sector