Web Analytics Made Easy - StatCounter

Dichloromethane Tenders

Get complete information related to latest Dichloromethane Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Dichloromethane Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Dichloromethane Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

Central Government/Public Sector

CTN :40031868 Due date: 01 May, 202501 May, 2025 NA
Tender For supply of chemical mdtl - bromocresol purple 25 gm , 2 butanol 1 litre , benzoic acid 100 gm , crystal voilet 100 ml , ethyl acetate hplc grade 2.5 litre , 1 hexane sulphonic acid 25 gm , isopropyl alcohol ipa hplc grade 2.5 litre , methanol hplc grade 2.5 litre , methanol ar grade 2.5 litre , potassium dichromate 500 gm , sodium acetate 500 gm , tetra butyl ammonium hydroxide 100 ml , orthophosphoric acid hplc grade 2.5 litre , triethylamine ar grade 500 ml , trypsin 25 gm , 1 naphthol 100 gm , potassium chromate 500 gm , di sodium tartrate dihydrate 500 gm , tetra hydrofuran hplc grade 1 litre , dimethylsulphoxide hplc grade 1 litre , acetonitrile hplc grade 2.5 litre , acetonitrile ar grade 2.5 litre , acetone hplc grade 2.5 litre , acetone ar grade 2.5 litre , potassium chloride 500 gm , dichloromethane hplc grade 2.5 litre , mercury iodide 100 gm , sodium dihydrogen phosphate 500 gm , sodium 1 decanesulfonate 200 gm , fluid thioglycollate medium ftgm 500 gm , soyabean casein digest medium scdm 500 gm , 1 chlorobutane 500 ml , sterile cotton roll 500 gm , conical flask 250 ml , clear reagent bottle 250 ml

Central Government/Public Sector

CTN :40033483 Due date: 07 May, 202507 May, 2025 22.22 Lacs
Tender For procurement of mri contrast for radio diagnosis department aiims bhopal - mri contrast, gadodiamide (0.5mmol/ml) x 10ml (linear non- ionic), gadopentate dimeglumine (0.5mmol/ml) x 10ml (linear ionic), gadoterate meglumine (0.5mmol/ml) x 10ml (macrocyclic ionic), one molar mri contrast agent: gadobutrol x 5ml (vial), one molar mri contrast agent : gadobutrol x 5ml ( syringe)

CTN :39964794 Due date: 30 Apr, 202530 Apr, 2025 NA
Tender For supply of paint remover / stripper chemical, dichloromethane based (weight% -60-85) (item code 1000370124)

Central Government And Public Sector

CTN :39971221 Due date: 01 May, 202501 May, 2025 NA
Tender For supply of industrail x ray film - very fine grained, high contrast, type- ndt-4 industrial x- ray film. size 12inchx15inch or 30cm x 40cm in pack of 50 sheets. , very fine grained, medium speed, high contrast class-1 industrial x-ray film, type- ndt-5. size 12inchx15inch or 30cm x 40cm in pack of 50 sheets. , fine grained, high contrast, high speed class-ii industrial x-ray film, type- ndt-7. size 12inchx15inch or 30cm x 40cm in pack of 50 sheets. , film cutter, size 16inch or 40cm or higher but less than 20inch or 50cm. , x-ray film pvc cassette double envelope inner and outer size 12inch x 15inch with lead intensifying screen front 0.10mm and back 0.15mm. , x-ray film pvc cassettes double envelope inner and outer size 3inch x 5inch with lead intensifying screen front 0.10mm and back 0.15mm. , x-ray film pvc cassettes double envelope inner and outer size 3inch x 7.5inch with lead intensifying screen front 0.10mm and back 0.15mm. , x-ray film pvc cassettes double envelope inner and outer size 4inch x 6inch with lead intensifying screen front 0.10mm and back 0.15mm. , astm e-747 wire type iqi or penetrameter 1a, ss material. , astm e-747 wire type iqi or penetrameter 1b, ss material. , astm e-747 wire type iqi or penetrameter 1c, ss material. , astm e-747 wire type iqi or penetrameter 1d, ss material. , astm hole type pentameter as per astm-e1025 with calibration certificate, material carbon alloy and stainless steel. no. 5,7,10,12,15,17,20,25,30,35,40,45,50, 5 numbers each. , set of lead number 0 to 9 for industrial radiography testing, size 5mm to 6mm. , set of lead number 0 to 9 for industrial radiography testing, size approx. 10mm. , set of lead letter a to z for industrial radiography testing, size 5mm to 6mm. , set of lead letter a to z for industrial radiography testing, size approx. 10mm. , developer powder make to 13.5 ltrs., industrial radiography film processing chemical. , fixer with hardener powder make to 13.5 ltrs., industrial radiography film processing chemical. , wetting agent for industrial radiography film processing, wash purpose, make to 200 ltrs. , industrial yellow chalk. , industrial x-ray film, type- ndt-2. size 12inchx15inch or 30cm x 40cm in pack of 50 sheets. , astm hole type pentameter as per astm-e1025 with calibration certificate, material aluminum. no. 5,7,10,12,15,17,20,25,30,35, 40,45,50, 5 numbers each.

Central Government/Public Sector

CTN :39897831 Due date: 23 Apr, 202523 Apr, 2025 NA
Tender For supply of solvents - hexane takara , acetonitrile sigma , toluene sigma , dichloromethane 1 , dichloromethane 2

Central Government/Public Sector

CTN :39835162 Due date: 16 Apr, 202516 Apr, 2025 NA
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76
 Loading, Please wait...

Connect us via What's Up