Ferric Chloride Hexahydrate Tenders

Get complete information related to latest Ferric Chloride Hexahydrate Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Ferric Chloride Hexahydrate Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Ferric Chloride Hexahydrate Tenders .

Filter

Loading....

Get Tender in Email

Central Government/Public Sector

CTN :40025038

07 May, 2025 4.20 Lacs

Sambalpur - Odisha

Tender For supply of lab equipment - charts , models , slide permanent , specimens , pictures posters charts , beaker , dropping bottle , forceps , funnel , micro viewers , microscope , petri dish , pipette , skeleton , test tube holders , test tube stand , watch glass , water bath , wash bottle , burette , capillary tube , thermometer , ammonium solution , chromatography paper , formaldehyde , glycerine , robert solution , micro cover slip , micro glass slides , millions reagent , needle , nitric acid , sucrose , test tube ordinary , ph paper , blade for section cutting , acetic acid , brushes , blow pipe , burette stand , test tube brush , cork borer , cork presser , crucible tongs , charcoal slab borer , crucible , deflagrating spoon , distilation apparatus , drying cones , funnel stand or filter stand , pestle and mortar , pinch cock , retort stand , round file , sand bath , spirit lamp , test tube stand , test tube holder , triangular stand , tripod stand , trough , wire gauze , triangular clay pipes , beehie sheft , burettle , china dish , conical flasks , dessicator , gas jar dises , flasks , gas jar or cylinder , glazed tile , measuring flasks , retort , thistle funnel , woulfes apparatus , watch glass , ammonium carbonate , ammonium chloride , ammonium sulfate , ammonium bromide , aluminum sulfate , iron sticks , potassium nitrite , ammonium oxalate , sodium thiosulphate , zinc sulfate , cobalt nitrate , sodium hydroxide , copper sulfate , potassium nitrate , oxalic acid , magnesium sulfate , magnesium chloride , ammonium phosphate , sodium chloride , potassium ferrocyanide k4fe cn 6 , ferrous sulfate , sodium bromide , ammonium ferrous sulfate , potassium dichromate , barium chloride , strontium nitrate , sodium sulphide , potassium chromate , lead acetate , sodium sulfate , potassium iodide , lead nitrate , cedric ammonium nitrate , 2,4 dnp , universal indicator , ammonia solution nh4oh , phenol , aniline , bromine water , acetaldehyde , fehling solution a b , acetone , carbon disulfide , phenolphthalein , nesslers reagent , ammoniumm olybdate , nickel carbonate , nickel sulfate , manganese chloride , calcium chloride , sodium bisulphate. , cobalt acetate , chloroform , magnesium ribbon , zinc granual , lead nitrate pb no3 2 , potassium iodide ki , lead metal pb , ethyl acetate , sodium metal , pottasium permanganet kmno4 , pottasium dichromate k2cr2o7 , hydro chloric acid hcl , sulphuric acid h2so4 , nitric acid hno3 , ethanol , test tube , test tube holder , dropper glass , filter paper , glass rod , sodium sulfite , picric acid , borax , cobalt glass , aluminum metal , spatula , laboratory thermometer , drawing board , friction apparatus complete set with weight box , parallelogram apparatus , helical spring apparatus with weights , resonance apparatus , spherometer , screw gauge , wooden scale , stopwatch , sonometer set , sprit level , vernier calliper , beakers , connecting wires , concave mirror , convex mirror , convex lens , concave lens , glass slab , pendulum bob , cork rubber , hanger weights , metalic bob , slinky spring , spring balance , copper calorimeter , wave pendulum , barometer tube , lactometer , proof plane , boyles law apparatus , fortnis barometer , metallic cylinders brass , metal sphere , youngs modulus apparatus , hydrometer , tunning fork , rubber pad , copper sulphate bid details/ 2 / 142

CTN :40002905

28 Apr, 2025 4.09 Lacs

Narsapur - Andhra Pradesh

Tender For supply and delivery of head water works water supply and maintenance materials in narsapur municipality - supply and delivery of following water supply head water works maintanance materials including all cost and conveyenace and all materials and charges etc.,, 1) 110 mm c i valves , 300mm ci valve ss spindle rods, brass nuts (300mm ci valve ss spindle rods), 250mm ci valve ss spindle rods, brass nuts(250mm ci valve ss spindle rods ), 200mm ci valve ss spindle rods, brass nuts (200mm ci valve ss spindle rods), 150mm ci valve ss spindle rods, brass nuts( 150mm ci valve ss spindle rods), 110mm ci valve ss spindle rods, brass nuts (100mm ci valve ss spindle rods), copper sulfate , 1 inch brass ball valves, 3/4 inch brass valves, 1/2 inch brass valves, 12 mm packing rope, 8mm packing rope, 4 inch pvc foot valves, 3 inch pvc foot valves, 2.5 inch pvc foot valves, 2 inch pvc foot valves, 1 inch pvc foot valves, 4inch ms flanges with threds, 6 inch ci foot valve atta full leather 4 holes, 1 inch hose pipe roll heavy duty, 3/4 inch hose pipe roll heavy duty, taparia greez guns 445 cc, taparia wrench set 6mm to 32mm , taparia ring wrench set 6mm to 32mm , taparia bench wise 5 inch , taparia plier , bosch cutter 800watt, hacksaw frame , hacksaw double side blades, electrical gum tapes , kathulu , reku kodavallu , bleaching bags for cleaning, supply of 48" (1200mm) sweep star rated ceiling fan, with double ball bearings, air delivery more than 200 cubic meter/min, but without regulator., makes: as per list of recommended brands. mat 03599 and ele5.1.3makes: crompton (hs plus/hs) / havells (es plus/ss390es) /orient energy star/halonix(zephyr)/polycab(synergy 50 isi) / g.m. (air wave premium)/bajaj-edge/arcline (glacier)., supply & delivery of 125a 3 pole mccb,25 ka mccb, adjustable, confirms to iec 60947-2 and is 13947-part 1 & 2, having breaking capacity . with thermal magnetic release panel mounted., makes: as per list of recommended brands as category i 125a 3 pole mccb,25 ka

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Loading, Please wait...

Ferric Chloride Hexahydrate Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector