Ferric Chloride Hexahydrate Tenders

Get complete information related to latest Ferric Chloride Hexahydrate Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Ferric Chloride Hexahydrate Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Ferric Chloride Hexahydrate Tenders .

Filter

Loading....

Get Tender in Email

CTN :40004862

02 May, 2025 NA

Mathura - Uttar Pradesh

Tender For supply of pathological items - elite 580 diluent 20 ltr , elite 580 lyse i 1x500ml , elite 580 lyse ii 1x500ml , elite 580 lyse iii 1x1000ml , elite 580 control h n l , elite h clean 1x50ml , calibrator elite 580 , glucose xl system pack 10x44ml , urea xl system pack 5x44ml , creatnine xl system pack 5x44ml , uric acid xl system pack 5x44ml , chloride xl system pack 10x12ml , cholesterol xl system pack 10x44ml , triglycerides xl system pack 5x44ml , hdl xl system pack 4x30ml , ldl cholesterol with cali xl system pack 2x30ml , total bilirubin xl system pack 6x44ml , direct bilirubin xl system pack 6x44ml , protein xl system pack 10x44ml , albumin xl system pack 10x44ml , sgot xl system pack 6x44ml , sgpt xl system pack 6x44ml , alkaline phosphates xl system pack 2x44ml , amylase xl system pack 5x22ml , lipase xl system pack 1x44ml , ldh xl system pack 2x44ml , ckmb xl system pack 2x44ml , ckanc xl system pack 2x44ml , calcium xl system pack 10x12ml , ggt xl system pack 2x44ml , phosphorous xl system pack 10x12ml , microprotein with cali xl system pack 10x12 ml , microalbumin with cali xl system pack 2x25ml , hba1c with cali set xl system pack 2x15ml , fe- 125 iron xl sx pk r14x25ml r2 2x 12.5ml cal2x2 ml , ferrritin 2x14.5ml , ferritin calibrator 1x1ml , ferritin control 1x1ml high , ferritin control 1x1ml low , uibc 125 tibc r1 4x25 ml r2 2x12.5 ml calib 2x2 ml , xl crp with cali 2x22ml , xl rf with cali 1x22ml , erba norm 4x5ml , erba path 4x5ml , xl multical 4x3ml

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Loading, Please wait...

Ferric Chloride Hexahydrate Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector