Latest glucose Tenders | Government glucose Tenders

Central Government/Public Sector

CTN :45546655

22 Jun, 2026 NA

Lucknow - Uttar Pradesh

Tender For supply of glucose kit (god-pod) with standard for auto analyzer & semi auto analyzer-- incubation time less than or equal to 8 minutes- flow cell temperature 37c -with program sheet for olympus au - 400 [ warranty period: 30 months after the date of delivery ] ]

Central Government/Public Sector

CTN :45548852

25 Jun, 2026 NA

Allahabad - Uttar Pradesh

Tender For supply of glucose (liquid), 9x51ml. in per pack. (item no. 4474 (pac) of ami 2026 - 27).[quantity tolerance (+/-): 5 %age , item category : normal , total po value variation permitted: max 8 lacs ] ]

Central Government/Public Sector

CTN :45551698

06 Jul, 2026 NA

Samba - Jammu And Kashmir

Tender For supply of blood glucose test strip , blood groupkit , cotton , rapid diagnostic card , disposable syringe , disposable needle , ecg paper roll , ecg paper roll , hiv rdk , hbsag rdk , lancets , malaria card , rapid diagnostic card , surgical sprit , gloves surgical rubber , troponin enzyme test card , urine test strip , typhoid test kit

CTN :45551746

25 Jun, 2026 NA

Mathura - Uttar Pradesh

Tender For supply of ready made water culture pa e coli kit for detection of presence or absence of coliform bacteria in water , oral glucose powder , tissue paper roll , medicated dressing spot handiplast round pack of 100 , ahg gel card pack of 24 test , ethyl alcohol , widal test kit , reticulocytes count stain 100ml , easylite trilevel control of 3x10ml , multistix 10sg pack size 1x100 strips , thermal printer paper roll pack size roll , check stix combo pack control , uniplastin pack size 12x5ml , liquicillin pack size 3ml , elite 580 control h n l , calibrator elite 580 , ebra h 360 calibrator and qc , erba h 360 control h n l , crp latex reagent , single reaction cuvette src ebra , sample detector electrolyte analyser , rf latex kit , urine strips , ppd vial of 10 ml , pm kit for erba 200 , elite 580 lyse i , elite 580 lyse ii , elite 580 lyse iii

CTN :45511941

02 Jul, 2026 NA

Gaya - Bihar

Tender For 250 mg , cap imatinib mesylate 100mg , cap fluvoxamine 50 mg , tab haloperidol 5mg , tab serratiopeptidase 5mg , tab gliclazide xr 60 mg plus metformin xr 500 mg , tab baclofen 10 mg , urdodesoxycholic acid 300 mg liver , amlodipine 2 point 5 mg , tab donepezil 5mg , tab medroxy progesterone 10mg , tamsulosin hcl 0 point 4 mg plus dutasteride 0 point 5 mg , tab rizatriptan 10 mg , zinc sulphate 20mg , tab isoxsuprine 10mg , tab digoxin 0 point 25 mg , indomethacin 25 mg tab oblique cap , diclofenac suppositories , tab methyldopa 250mg , succinylchloline chloride 50 mg oblique ml 2 ml inj , tab nebivolol 50 mg , tab indomethacin 75 mg sr tab , tab nitrofurantoin 100 mg , tab tramadol hcl 50 mg , tab etoricoxib 120 mg , esomeprazole 20 mg plus domperidone 30 mg , inj clindamycin 300 mg , qutiapine sr 100 mg , inj labetalol hcl 5mg oblique ml 4ml , tolperison 150 mg , ethamsylate 250 mg oblique 2 ml inj , thiocholchiside 8 mg , inj imipenem 500 mg , novel ravies monoclonal antibody cocktail containing docaravimab and miromavinab 600 iu oblique 1 ml , conjugated estrogen 0 point 625mg premarin , novel ravies monoclonal antibody cocktail containing docaravimab and miromavinab 1500 iu oblique 2 point 5 ml , inj adenosine 3 mg oblique ml 2 ml , indicator soda lime , tab dexamethasone 0 point 5 mg , pantoprazole 40mg plus domperidone 30 mg , inj lorazepam 2 mg oblique ml 2ml , tab isosorbide dinitrate 10 mg , tab ketorolac 10mg tab , tab trihexyphenidyl hcl 2 mg , tab silodisin 4 mg , tab atorvastatin 40 mg , esomeprazole 20mg , tab clomipramine hcl 25mg , inj lignocaine hcl solution 2 percent for iv use 50 ml without methyl rabite xylocaine , cap flucanozole 50 mg , tab ropinirole 0 point 25 mg , tab paroxetine 20 mg , aceclofenac 100mg plus serratiopeptidase 15mg plus paracetamol 325mg , tab betahestine 16 mg , dinoprostone pge2 10 mg pessary , l arginine collagen peptides type i sodium hyaluronate chondroitin sulfate and vitamin c tendocare forte , multivitamin with l methionine and selenium , cap vit a 50000iu , tab thiamine , amlodipine 5 mg plus telmisartan 40 mg , tab sitagliptin 50mg plus metformin 1gm , tab cyproheptadine 4 mg , tab phebnobarbitone 30 mg , tab enalapril 5mg , tab tenofovir 300mg , tab lamotrigine 50mg , tab sodium valproate cr 500 mg , acarbose 25 mg , pioglitazone 30 mg , tab hydrochlorothiazide 25mg , tab chlorpromazine 25mg , chlordiazepoxide 5 mg plus clidinium bromide 2 point 5 mg , tab topiramate 50mg , tab bicalutamide 50 mg , inj adrenaline tartrate 1 ratio 1000 1 ml , tab dutasteride 0 point 5mg , inj dopamine hcl 40 mg oblique ml 5ml , tab metoclopramide 10 mg , tab resperidone 4 mg , tab mefenamic acid 500mg , phenytoin sodium 300 mg , tab azathioprine 50mg , tab doxepin 25 mg , tab tenofovir alphamide 25 mg , tab carbimazole 5mg , tab telmisartan 40mg , tab trimethoprim and sulphamethoxazole ip cotrimazole ds , cap fluoxetine hcl 20mg , tab dienogest 2mg , tab enalapril maleate 2 point 5 mg , alendronate sodium 70mg tab , tab leflunomide 20 mg , tab bisacodyi 5mg , tab torsemide 20 mg , tab olmesartan 40mg , tab qutiapine 25 mg , ginkgo biloba 120 mg , sitagliptin 50 mg , piracetam 800 mg , tab piracetam 800mg and citicolin 500mg , rabies immunoglobulin , glucose saline isotonic solution in non toxic disposable plastic bott of 500ml ffs oblique dns , pad abdominal swab 25 x 25 cm with tape 30 cm , pad abdominal swab 40 x 25 cm with tape 30 cm , inj atropine sulphate 0 point 6 mg oblique ml , inj noradrenaline //bid details 2 / 130 bitartrate 2 mg oblique ml 2 ml , inj promethazine hcl 2 point 5 percent 25 mg oblique ml 2 ml , inj vasopressin 20 units oblique ml 1ml ampoule , inj oxytocin 5 units per 1 point 0 ml amp , inj thiamine , syp dextromethorphan hydrobromide and hlorpheniramine maleate syrup bott of 60 ml for pediatric tixlic , tiotropium bromide 9 mcg 120 metered doses oblique unit inhaler , inj magnesium sulphate 50 percent w oblique v , ipratropium bromide respirator soln 500 mcg obliqu

Central Government/Public Sector

CTN :45512021

02 Jul, 2026 9.50 Lacs

Kamrup - Assam

Tender For n hexane , n hexadecane , dipotassium phosphate k 2 hpo 4 , potassium dihydrogen phosphate kh 2 po 4 , magnesium sulfate heptahydrate e- mgso 4 .7 h2o , toluene , xylene , brain heart infusion broth , lb broth , nutrient broth , soluble starch , iodine , skim milk sm agar , d- glucose , dpph 2 2 diphenyl-1-picrylhydrazyl , 2,4,6-tris 2-pyridyl-s- triazinetptz , ferric chloride anhydrous , acetate buffer , ferrous sulfate , triton x-100 octylphenol ethoxylate , dulbeccos modified eagle medium dmem , mrs broth , mrs agar , hydrogen peroxide , glycerol , sodium chloride , potassium chloride , calcium chloride , sodium bicarbonate , methanol , ethanol , peptone powder , yeast extract powder , l-cysteine hydrochloride , magnesium sulfate monohydrate mgso4 h2o , porcine t3 triiodothyronine elisa kit , porcine t4 thyroxine elisa kit , mda malon dialdehyde elisa kit , porcine sod1 superoxide dismutase cu-zn elisa kit , porcine cat catalase elisa kit , porcine igg immunoglobulin g elisa kit , porcine il-10 interleukin 10 elisa kit , porcine cortisol elisa kit , porcine tnf- tumor necrosis factor alpha elisa kit , porcine il-1 interleukin 1 alpha elisa kit , molecular grade ethanol , ethidium bromide , agarose powder , 10 x tae buffer , pcr master mix , nuclease free water , rna extraction kit , cdna synthesis kit , histopaque , chloroform , isopropanol , trizol , microcentrifuge tubes zero point five ml , microcentrifuge tubes 0.2 ml , pcr tube strips , microcentrifuge tubes 2 ml , microtube rack , pcr tube rack , pipette tips-10 microlitre , pipette tips-200 microlitre , pipette tips-1000microlitre , pipette holder , gloves , slide storage box , cryo box , cryo tags , petridish , glass wash bottle set 500 ml , burette 50 ml , volumetric flask 100 ml , sodium hydroxide pellets 5 kg , hydrochloric acid hcl 2.5 lit , sulphuric acid 2.5 lit , nitric acid 2.5 lit , perchloric acid 2.5 lit , petroleum ether 2.5 lit

Central Government/Public Sector

CTN :45512069

26 Jun, 2026 NA

Dantewada - Chhattisgarh

Tender For supply of medicine consumables items h h - medicine steel rack heavy , infant radiant warmer , revolving chair , steel chair , office table small , office table big , bed sheet 7 color , pillow , pillow cover , urine container , table cloth rexine , tab diclofenac 50mg , tab folic acid 5mg , tab calcium vit d3 , tab norflox-tz , tab cefixime 100mg , tab cefixime 200mg , syp metronidazole , syp zinc sulphate , syp cof-q , syp pcm 125mg , syp pcm 250mg , inj thiamine , inj ondansetron , inj phenytoin , inj vitamin k1 , inj ranitidine , inj adrenaline , inj tranexamic acid , ors , cream miconazole , eye ear drops ofloxacin , ear drops tobramycin , spirit 500ml , pediatric drop pcm 100mg per ml , pediatric drop multivitamine , iv cannula no.24 , iv cannula no.26 , iv rl 500ml , iv ns 500ml , iv metrosyl 100ml , iv set , gauzethan , rolle bandage 2 inch , rolle bandage 4 inch , rolle bandage 6 inch , suture absorable 3 no. , catgat half circle round , card clamp , garbage bag mix color m , garbage bag mix color b , dispo 5ml , ecg jelly , widal test kit , iodine salt test kit , register 200 page , register 300 page , stock register 300 page , stock register 400 page , carbon blue a4 , file cover , file pad , highlighter , stamp pad big , stapler machine big , stapler machine small , stapler pin small , stapler pin big , brown tape , tag , pen blue , pen red , pen green , oxygen flowmeter , bp machine digital dr. morphen , weight machine digital , stediometer , hb machine quick check , needle cutter electric , focus light , nebulizer machine , baby weight machine , suction machine , instrument sterilizer machine , kellys pad , artery forceps , needle holders 6 inch , sponge holding 8 inch , nasal speculum , mouth gag , dissecting forceps , dressing scissors , plain scissors , bandage scissors , mayo scissors , suture blade no.11 //bid details 2 / 74

Central Government/Public Sector

CTN :45512256

02 Jul, 2026 NA

Gwalior - Madhya Pradesh

Tender For supply of cell biological items c c - hacat cells , hff1 cells , dmem, high glucose pyruvate , 5 uaauuucuacuaaguguagau gauccguaaguccaugacgu 3 , 5 uaauuucuacuaaguguagau cuagguaccgacguagcauc 3 , 5 uaauuucuacuaaguguagau cgaugucagcuaagccgucg 3 , 5 uaauuucuacuaaguguagau ggaacguacgugagucguag 3 , 5 uaauuucuacuaaguguagau gcuagacugacgcgaugcug 3 , 5 uaauuucuacuaaguguagau guagcgugacgcgagcuagg 3 , 5 uaauuucuacuaaguguagau acgguccgauagcggacucg 3

Central Government And Public Sector

CTN :45471425

15 Jun, 2026 NA

Lumding - Assam

Tender For supply of medical boxes having medicines, consumables and oxygen cylinder etc at all railway stations - band aid strips wash proof (1.987.2 cms), povidone lodine lotion 100 ml, surgi pad 7.5 cms x 20 cm, sterile adhesive strip dressing (standard size), rubber tourniquet, roller bandages (7.5 cm x 4 mtr) gauze, triangular bandages (130cm x 90 cm x 90 cm), set of six wooden/polymer extensible splints (st. john ambulance type), antiseptic cream 25 gms, safety pin set of 10, injury card, adhesive plaster (2.5 x 4/5 metres), scissors dressing, pencil torch with batteries, oral rehydration powder, antiseptic spray dressing, cotton wool 100 gms, sterile absorbent gauze pad (7.5 x 7.5), sterilsed absorbent cotton wool (25 gms), tab. antacid, tab, paracetamol 500 mg, tab. isosorbide dinitrate (sub-lingual), anti-infammatory spray, xylometazoline nasal drop (0.1%), disposable sterile gloves 7.5", first aid box card for accountal, stethoscope, b. p. apparatus (aneroid type) with both adult cuff & paediatric cuff, digital thermometer, portable oxygen cyliner aluminium "aa" type reusable with accessories eg. flowmeter, 02 face mask with tubings - adult, paediatric, aed with 4 pads, newborn delivery kit, disposable syringes 2 cc. 5 cc, 10 ce, needles size 20 & 24, disposable iv set, saline ampoules 5 ml, normal saline plastic bottle 500 ml, 4.6 oral airway (guedel oro-pharyngeal) size: 0, 2, 4, 6ambu bag adult and child with mask, anti-spasmodic drop, anti-spasmodic syrup, chromic catgut 1-0 with cutting needle, curved artery forceps 6", diclofenac syrup, disposable spirit swabs, endotracheal tube disposable (sizes 3, 4, 5.6.7 mm), hard cervical collar, injection 2% xylocaine, injection 25% dextrose, injection adrenaline 1:1000, injection atropine | ml, injection deriphylline, injection diazepam, injection diclofenac sodium (1 ml/75 ing), injection drotaverine, injection frusemide, injection hydrocortisone 100 mg, injection ondansetron 4 mg, injection paracetamol (plastic bottle), injection pheniramine malente 25 mg, injection ranidine, intravenous cannula 20" & 24", laryngoscope with set of 3 different size blades with batteries, needle holder medium size straight, salbutamol metered dose inhaler, savlon-100 ml, scissors surgical mayos 6", silk sutures 1-0 with cutting needle, suction pump-foot/hand operated (portable) with suction catheter & 14" (catheters 10 each), syp domperidone, syp paracetamol, syp pheniramine, tab non-enteric coated aspirin 300-350 mg, tab pantoprazole 40 mg, tab. diazepuni 5mg, tab. dicyclomine hel, tab. domeperidone (dispersible tablet) 10 mg, tab. ibuprofen (400mg)/ diclofenac sodium (50 mg), tab. levocetirizine 5 mg, tah amlodipine (5 mg), toothed dissecting forceps, medium size

CTN :45543063

24 Jun, 2026 39.97 Lacs

Hisar - Haryana

Tender For supply of sulphasalazine 500 mg tab , inj ondansetron 2 mg ml , ketoconazole 2 pcnt zinc pyrithione 1 pcnt lotion 60 ml , inj pantoprazole 40 mg , atracurium 10 mg ml 2 pnt 5 ml inj , theophylline sr 400 mg tab , thiamine 100mg tab , thiocolchicoside 4 mg tab , topiramate 25 mg tab , tramadol 50 mg cap , tretinoin 0 pnt 025 pcnt oint tube of 15 gm , desvenlafaxamine 50 mg tab , xylometazoline 0 pnt 1 pcnt w v nasal drops bott of 10 ml , fuji film dry imaging films di hl 8 x10 pac pkt of 150 , fuji film dry imaging films di hl 10 x12 pac pkt of 150 , fuji film dry imaging films di hl 11 x14 pac pkt of 150 , disposable ceasarean kit , sodium chromoglycate e d 2 pcnt , acamprosate calcium 333 mg tab , dressing first aid unmedicated sterile strip size 1 x3 , clotrimazole 1 pcnt ear drops botts of 10 ml , donepezil 5 mg tab , escitalopram 10 mg tab , hyoscine butylbromide 20mg ml 1 ml inj , metronidazole inj for iv use containing 500 mg per bott of 100 ml , lacosamide 50 mg tab , lactobacilllus 1 gm sachet , lorazepam 2 mg tab , pyridoxine 100 mg tab , rabeprazole 20mg plus itopride 50mg tab , ranolazine 500 mg tab , riboflavin 10 mg tab , silver nitrrate 0 pnt 2 pcnt chlorhexedine 0 pnt 2 pcnt oint 15 gm , sodium chloride 5 pcnt eye drops bott of 10 ml , solifenacin 5 mg tab , sulphacetamide 20 pcnt w pnt v e d amber self dropper bott 10 ml , terbinafine 1 pcnt cream tube of 10 gm , torsemide 100 mg tab , triamcinalone 0 pnt 1 pcnt w w for oral use tube of 10 gm , verapamil 120mg sr tab , warfarin 1mg tab , anti sera a kit estimat bld group abd contain anti sera a b and anti d 5 ml , cholesterol kit , cover glass strips 22 x 55 mm , creatinine kit , crp kit span , dengue test kit ns1 antigen igg and igm kit of 10 tests , esr disposable pipette pack of 100 , hbsag kit , hcv tri dot rapid card pack of 100 tests , hdl kit , ketodiastix strip , ketostick bott 100 strip , kit for estimation of alkaline phosphate , kit for estimation of bilirubin pnt , kit for estimation of cholestrol pnt , kit for estimation of glucose pnt , kit for estimation of hdl pnt , kit for estimation of triglyceride pnt , kit for estimation of uric acid pnt , lancet needle , leishman stain solution ready to use bott of 500 ml , malaria ag pf pv rapid card pack of 50 tests , slide microscope thickness 1 pnt 15 to 1 pnt 35 mm size 75 mm x 25 mm , rapid card test for pregnancy , sgot kit , sgpt kit erba , test tube 100x12mm , triglyceride , typhoid igg igm rapid test kit of 30 tests , urea kit , uric acid , urine container disposable , vaccum blood collection tube sterile with sodium fluoride pnt 2 3 ml , vaccutainer needle , widal test , h 360 dilute 20 , h 360 lyse 500 ml , elite h clean 50 ml , hdl cholestrol fs 4x200 test for diasys , ldl cholestrol fs 4x200 test for diasys , ra factor fs 2x20 ml , crp latex reagent , crp rapid card , widal //bid details 2 / 68

Glucose Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government And Public Sector