Latest glucose Tenders | Government glucose Tenders

Central Government/Public Sector

CTN :45551698

06 Jul, 2026 NA

Samba - Jammu And Kashmir

Tender For supply of blood glucose test strip , blood groupkit , cotton , rapid diagnostic card , disposable syringe , disposable needle , ecg paper roll , ecg paper roll , hiv rdk , hbsag rdk , lancets , malaria card , rapid diagnostic card , surgical sprit , gloves surgical rubber , troponin enzyme test card , urine test strip , typhoid test kit

Central Government/Public Sector

CTN :45512256

02 Jul, 2026 NA

Gwalior - Madhya Pradesh

Tender For supply of cell biological items c c - hacat cells , hff1 cells , dmem, high glucose pyruvate , 5 uaauuucuacuaaguguagau gauccguaaguccaugacgu 3 , 5 uaauuucuacuaaguguagau cuagguaccgacguagcauc 3 , 5 uaauuucuacuaaguguagau cgaugucagcuaagccgucg 3 , 5 uaauuucuacuaaguguagau ggaacguacgugagucguag 3 , 5 uaauuucuacuaaguguagau gcuagacugacgcgaugcug 3 , 5 uaauuucuacuaaguguagau guagcgugacgcgagcuagg 3 , 5 uaauuucuacuaaguguagau acgguccgauagcggacucg 3

Central Government/Public Sector

CTN :45546655

22 Jun, 2026 NA

Lucknow - Uttar Pradesh

Tender For supply of glucose kit (god-pod) with standard for auto analyzer & semi auto analyzer-- incubation time less than or equal to 8 minutes- flow cell temperature 37c -with program sheet for olympus au - 400 [ warranty period: 30 months after the date of delivery ] ]

State Government

CTN :45491316

18 Jun, 2026 8.00 Lacs

Sikar - Rajasthan

Tender For supply of lab items - c.b.c printer roll , edta k 3 vial 2 ml double cap , esr pipte disposable with citrate bulb , ecg jelly , j.s.b. stain 1 & 11 , 3.8 sodium citrate , cappilary tube , filter paper , hb meter , n/10 hcl,hb tube , blood group kit(igg + igm). , cover slips , glass slide , widal kit , vdrl card , hiv card , urine container , urine multi strip(9 strip) sd , urine strip(alb. sugar) , pragnancy card , deionized water(dw) , tissue paper , clinic spirit , cotton roll (500gm) , syringe (2 ml, 3 mi & 5 mi available) , niddle(24 no) lencet , supplies , soup bar , dropper , abx midili (20 ltr.) , abx cleaner (1 ltr.) , abx lyse (1 ltr.) , minicalir (1 ltr.) , c.b.c. control, positive, negative , hbs ag rapid test , glucose kit liquid , blood urea liquid , creatinine liquid , bilirubin liquid , sgot liquid , sgpt liquid , alk. phasptase liquid , total protien liquid , colestrol liquid , trigelsrides(tg) liquid , hdl liquid , vldl liquid , album kit , glucometer strip , plain tube without cap) , plain tube with cap , s. ldh , tips - yellow (1-50 mc itr.) , tips - blue (1 mi.) , plastic tube rack , micro pippte stand , dropping bottle , glass beaker , oil immersion , accu-check (glucometer cell) , total albumin , 10 micro liter fix , 5-50 micro liter (variable) , 10-100 micro liter (variable) , 100-1000 micro liter (variable)

Central Government/Public Sector

CTN :45548852

25 Jun, 2026 NA

Allahabad - Uttar Pradesh

Tender For supply of glucose (liquid), 9x51ml. in per pack. (item no. 4474 (pac) of ami 2026 - 27).[quantity tolerance (+/-): 5 %age , item category : normal , total po value variation permitted: max 8 lacs ] ]

State Government

CTN :45514762

30 Jun, 2026 2.00 Lacs

Sagar - Madhya Pradesh

Tender For supply of medicine and medical products - generic/branded allopathic medicine, surgical item, pathological testing and item such as gaz, bandage, cotton rolls branded, hand sanitizer, and other all types ayurvedic, homeopathic medicine will be purchased if all medicines are not available from government firms. doctor's advice required.

Central Government/Public Sector

CTN :45512021

02 Jul, 2026 9.50 Lacs

Kamrup - Assam

Tender For n hexane , n hexadecane , dipotassium phosphate k 2 hpo 4 , potassium dihydrogen phosphate kh 2 po 4 , magnesium sulfate heptahydrate e- mgso 4 .7 h2o , toluene , xylene , brain heart infusion broth , lb broth , nutrient broth , soluble starch , iodine , skim milk sm agar , d- glucose , dpph 2 2 diphenyl-1-picrylhydrazyl , 2,4,6-tris 2-pyridyl-s- triazinetptz , ferric chloride anhydrous , acetate buffer , ferrous sulfate , triton x-100 octylphenol ethoxylate , dulbeccos modified eagle medium dmem , mrs broth , mrs agar , hydrogen peroxide , glycerol , sodium chloride , potassium chloride , calcium chloride , sodium bicarbonate , methanol , ethanol , peptone powder , yeast extract powder , l-cysteine hydrochloride , magnesium sulfate monohydrate mgso4 h2o , porcine t3 triiodothyronine elisa kit , porcine t4 thyroxine elisa kit , mda malon dialdehyde elisa kit , porcine sod1 superoxide dismutase cu-zn elisa kit , porcine cat catalase elisa kit , porcine igg immunoglobulin g elisa kit , porcine il-10 interleukin 10 elisa kit , porcine cortisol elisa kit , porcine tnf- tumor necrosis factor alpha elisa kit , porcine il-1 interleukin 1 alpha elisa kit , molecular grade ethanol , ethidium bromide , agarose powder , 10 x tae buffer , pcr master mix , nuclease free water , rna extraction kit , cdna synthesis kit , histopaque , chloroform , isopropanol , trizol , microcentrifuge tubes zero point five ml , microcentrifuge tubes 0.2 ml , pcr tube strips , microcentrifuge tubes 2 ml , microtube rack , pcr tube rack , pipette tips-10 microlitre , pipette tips-200 microlitre , pipette tips-1000microlitre , pipette holder , gloves , slide storage box , cryo box , cryo tags , petridish , glass wash bottle set 500 ml , burette 50 ml , volumetric flask 100 ml , sodium hydroxide pellets 5 kg , hydrochloric acid hcl 2.5 lit , sulphuric acid 2.5 lit , nitric acid 2.5 lit , perchloric acid 2.5 lit , petroleum ether 2.5 lit

Central Government/Public Sector

CTN :45302476

16 Jun, 2026 1.31 Lacs

Ganjam - Odisha

Tender For corrigendum : supply of urea kit , sgpt kit , sgot kit , creatinine kit , glucose kit , alkaline phosphatase kit , cholesterol kit , triglycerides kit , widal kit , bilirubin kit t and d , dispo van syringe 3.0 ml , plain vacutainer , sodium fluoride vacutainer , k3 edta vacutainer , sodium citrate 3.8 percent vacutainer , micro- tips 2-200 micro lit , uristix , uric acid kit , hemocor-d with standard , surgical spirit , cardigel , labolene , abo anti sera , leishmans stain solution , glucostrip , absorbent cotton 500 gm , glass slide pic-2 , test tube glass 12x75 mm , alcohol swab , spot band-aid , mal card , disposable esr pipette , hdl cholesterol kit , dispovan needle 23g x 1 inch

Central Government / Public Sector

CTN :44610237

15 Jun, 2026 7.95 Lacs

Kolkata - West Bengal

Tender For bid to ras bid to ras supply of glucose reagent hexokinase 5x44 ml or 5 x 12.5ml erba , hiv tri dot 50 test rapid kit j mitra , urea reagent erba r1- 5 x 44 ml or r2- 5 x 11 ml , erbaqik hbs ag erba , erba mannheim biochemistry reagent kit creatinine enzymatic 5x30ml or 5x10 , erba mannheim urine test strip multistix 100 per kit , malaria rapid test kit j.mitra , erba mannheim biochemistry reagent kit , sgpt 6x44 or 6x12.5ml , erba mannheim biochemistry reagent kit , sgot 6x44 or 6x12.5ml , aso titre for 25test latex arkray , erba mannheim alkaline phosphatase small system pack 5 x 22 ml or 5x6.8ml , glass slide 50 per box , erba c r p xl crp- turbilatex with calibrator 2x22ml and 2x6.7ml , uric acid erba r1- 5 x 44 ml or r2- 5 x 11 ml , erba mannheim biochemistry reagent kit , total protein 10x44ml , erba mannheim biochemistry reagent kit , albumin 5x22ml , j.mitra dengue rapid test kit ns1 antigen 25 tests per kit , j.mitra h c v rapid test kit 50 tests per kit , urine,stool,container b positive urine culture bottle 30 ml 25 per pack , himedia technical grade buffer solutions, size 500 milliliter per bott. , disposable vaccum esr pipette pack of 100 , bd blood specimen collection tube vacum clot activator plain vial 100 per box , bd blood specimen collection tube vacum edta vial 100 per box , bd vacuum blood collection tubes sodium fluoride and edta 2 milliliter 100 per box , erba serum bilirubin direct kit system pack 6 x 44 ml or 6 x 12.3ml , erba serum total bilirubin kit system pack 6 x 44 ml or 6 x 12.3 ml , vaccutainer needle blood collection needle 22g 100 per box , erba mannheim serum triglyceride kit r1- 5 x 44 ml or r2- 5 x 11 ml , tarsons virgin polypropylene snap cap centrifuge tubes tarsons 500 per box , erba mannheim urine test strip material- plastic erba mannheimr glucose and ketone test strips 100 per kit , widal test kit slide test 4 antigen set s. typhi o,s. typhi h, s. paratyphi ah and s. paratyphi bh 5ml x 4 , cdh type a microscope immersion oil, size 50ml in plastic bottle 50ml bottle , pregnancy rapid test kit pak of 10 kit , glass straight funnel 1 x 1 , black marker pen 1 x 1 , erbaqik dengue ns1 antigen and igm plus igg antibody detection rapid test kit of 10 test , erbaqik syphilis antibody rapid test kit of 25 test , erbaa mannheim biochemistry reagent kit , ldl cholesterol 2x30ml or 2x10ml , erba mannheim biochemistry reagent kit hdl cholesterol 4x30ml or 4x10ml , coral cholesterol reagent 10x44ml , erba mannheim biochemistry reagent kit , rf 1x22ml or 1x5.5ml , ethanol absolute ar 1 ltr bott , tourniket , sodium hypochlorite solution 4 percent 1 ltr bott , siemens urine test strips combistix 100 strips per kit , haemospot for occult blood 50 test per kit or coral 50 per kit , cell pack 20 ltr. sysmex 20 ltr per pack , cell clean sysmex 50ml per kit , stromatolyser wh sysmex 500ml per kit , printing paper roll for sysmex xp 100 roll , ppd 5 tu 5ml arkray 5ml per kit , control sera for biochemical test for low bio-rad kit of 5ml x 12 , control sera for biochemical test for high bio-rad kit of 5 ml x 12 , eight check 3wp tri level control for haematology sysmex 2ml x3 per kit , lens cleaning tissue paper , erba xl wash kit 100ml x10 per kit , multical transasia 3ml x 4 per kit , seroquant r.a. control level 1 , seroquant crp control level 1 , vaccutainer needle holder , sulphuric acid 20 percent bott of 100 ml , test tube cleaning brush , conical centrifuge tube glass 15ml borosil , microtips 200 - 1000 microlitre box of 500 , erba auto wash ac or al 5x44ml //bid details 2 / 41

CTN :45551746

25 Jun, 2026 NA

Mathura - Uttar Pradesh

Tender For supply of ready made water culture pa e coli kit for detection of presence or absence of coliform bacteria in water , oral glucose powder , tissue paper roll , medicated dressing spot handiplast round pack of 100 , ahg gel card pack of 24 test , ethyl alcohol , widal test kit , reticulocytes count stain 100ml , easylite trilevel control of 3x10ml , multistix 10sg pack size 1x100 strips , thermal printer paper roll pack size roll , check stix combo pack control , uniplastin pack size 12x5ml , liquicillin pack size 3ml , elite 580 control h n l , calibrator elite 580 , ebra h 360 calibrator and qc , erba h 360 control h n l , crp latex reagent , single reaction cuvette src ebra , sample detector electrolyte analyser , rf latex kit , urine strips , ppd vial of 10 ml , pm kit for erba 200 , elite 580 lyse i , elite 580 lyse ii , elite 580 lyse iii

Glucose Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors