Pyrogallol Tenders

Get complete information related to latest Pyrogallol Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Pyrogallol Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Pyrogallol Tenders .

Filter

Loading....

Get Tender in Email

CTN :39925929

16 Apr, 2025 6.54 Lacs

Ganganagar - Rajasthan

Tender For supply of lab chemicals at sstps(o and m),suratgarh.-, 1-amino-2-naphthol-4- , , sulphonic acid (1 pkt = 25 gm) , , ammonium chloride (1 pkt =500gm) , , ammonium molybdate tetrahydrate (1 pkt=500 gm) , , ammonium perpurate (1 pkt=5gm) , , acetone (1pkt= 500 ml) , , ammonia solution 25% (1 pkt=2.5 itr) , , acetic acid (1pkt= 2.5 ltr) , , bromo cresol green 0.04% indicator ph 3.6-5.2 yellowish-green (1pkt= 125 ml) , , bleaching powder (1 pkt =500 gm) , , conc. hydrochloric acid (1 pkt=500ml) , , chlorotex reagent (1 pkt =100 ml) , , diethyl ether (01 pkt=500 ml) , , ethanol (1 pkt =500 ml), , , etylene diamine tetra acetic acid disodium salt dihydrate (1pkt= 500gm) , , eriochrome/solochrome black -t (1pkt= 25gm) , , glycerol anhydrous (1 pkt =2.5 ltr) , , 1 n hydrochloric acid ampule (1 pkt= 06 no's) , , hexamine (1 pkt = 500 gm) , , hydroxyl amine hydrochloride (01 pkt=500 gm) , , isopropyl alcohol (1pkt= 2.5ltr) , , n/10 lodine ampule (1 pkt = 06 nos.) , , lead nitrate (1 pkt = 500 gm) , , methanol (1 pkt =2.5 ltr) , , methyl red 0.01% indicator solution ph 4.3-6.3 red-yellow (1pkt= 125 ml) , , mercuric thio cyanate (1 pkt= 100gm) , , nessler reagent (1 pkt = 100 ml) , , nitric acid (1 pkt= 2.5 ltr) , , oxalic acid (1 pkt =500 gm) , , o-toludine (1pkt= 500gm) , , para dimethyl amino benzaldehyde (1 pkt =500 gm) , , potassium hydroxide pellets (1 pkt =500 gm) , , e , , pyrogallol (1 pkt =100 gm) , , 1,10 phenenthroline (1pkt=5gm) , , phenophthalein indicator (1 pkt =125 ml), , , ph indicator paper (ph 1.0-14.0) with colour scale , , sodium meta bisulphite (1 pkt =500 gm), , , sodium sulphite (1 pkt =500 gm), , , sulphuric acid (1 pkt =2.5 ltr) , , sodium acetate (1pkt= 500gm) , , sodium hydroxide pellets (1pkt= 500gm) , , starch soluble (1pkt=500gm) , , n/10 sodium thio sulphate ampule , , silicone high vaccum grease (lab) (1pkt= 50 gm) , , 1 n sodium hydroxide ampule (1 pkt = 06 nos.) , , sodium potassium tartarate (1pkt=500gm) , , silver nitrate (01 pkt=100 gm) , , standard silica (1000 ppm) (1 pkt=500 ml) , , toluene (1pkt= 2.5 ltr) , , universal indicator ph 4-11 indicator with colour chart (1 pkt =500 ml), , , xylene (sulphur free) (1 pkt= 2.5ltr) , , xylenol orange indicator(01 , , pkt=10 gm) ,

Central Government/Public Sector

CTN :39971076

10 May, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for physics laboratory - rpmi1640 medium. hepes modifcation with l glutamine and 25mm hepes without sodium bicarbonate powder suitable for cell culture , fetal bovine serum non-usa origin sterile fltered suitable for cell culture , ethanol absolute. for analysis emparta acs , trypsin from porcine pancreas lyophilized powder bioreagent , thiazolyl blue tetrazolium bromide powder bioreagent suitable for cell culture suitable for insect cell culture , trypan blue solution , corning syringe flters , lb broth with agar , lb broth miller highly- referenced nutrient-rich microbial growth powder medium suitable for regular e coli culture , ethylene glycol analytical standard , ethylenediaminetetraacetic acid acs reagent , zinc acetate , polyvinylpyrrolidone mol wt number average molecular weight , gadolinium iii nitrate hexahydrate , chromium iii nitrate nonahydrate , cadmium chloride , n n dimethylformamide acs reagent , i sodium citrate anhydrous emprove essential , ascorbic acid , hydrogen peroxide solution , hydrazine hydrate solution , tetra-n- butyl orthotitanate , ferric nitrate nonahydrate , magnesium nitrate hexahydrate , samarium iii nitrate hexahydrate , acetic acid , poly vinyl alcohol pva , samarium iii oxide , niobium v oxide , molybdenum iv oxide , samarium powder for synthesis , cobalt ii chloride anhydrous , nickel ii chloride , lithium chloride , hydrofluoric acid , silver nitrate solution , ammonium hydroxide solution , silicon nanoparticles bid number/ & ( * ) : gem/2025/b/6128335 dated/ + : 09-04-2025 bid document/ 3 3 1 / 35

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Loading, Please wait...

Pyrogallol Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector