Latest pyrogallol Tenders | Government pyrogallol Tenders

Central Government/Public Sector

CTN :42226458

13 Nov, 2025 NA

Sundergarh - Odisha

Tender For corrigendum : tender for supply of 2575000049 stains d d - light green sf yellowish, packing-25gm, (colour index no-42095), eosin yellow,pack:25gm, aluminium ammonium sulphate, pack:20gm, methylene blue, ar, gr,25gm, make merck, bdh, brilliant crystal blue, pack:25gm, formic acid, make merck/qualigens/sd fine chem ltd/loba chemi/glaxo sk, mercury oxide(red), packing-100gm, card, thermo shandon filter, ref:5991022, thick (white), for use with samples 0.5mm, box of 200pcs, accessories for thermo shandon cytospin, from thermo electron corporation, any other reference, 5991022, microtome plastic embedding ring, size-25 mm, medium for ss moulds for histopathology use., blades,3153735 hp 35 ultra high profile, disposable blades used for microtome pack of 50 blades., oil, microscopic, immersion, make merck, manufacturer, : merck, article no, 6.15577e+13, calcium chloride, 0.25mm, pack:10x15ml, leishman stain powder, 25gm pack

State Government

CTN :42409964

11 Nov, 2025 NA

Srinagar - Jammu And Kashmir

Tender For corrigendum : supply of lithium bis trifluoromethanesulfonyl : - carbon disulide , tin ii ethylhexanoate , pyrogallol , glutaric acid , aluminium chloride , thiourea sd , dimethylamino pyridine , zinc sterate , zinc nitrate hexahydrate , o vanillin , bis pinacolato diboron , bisdiphenylphosphino ferrocene , benzenedimethanol , adamantanedicarboxylic acid , lithium bis trifluoromethanesulfonyl imi , diglycolic acid , zinc iodide , benzyl alcohal , nitrobenzoic acid , bromobutanoyl , ethyl acetate sa , dmso , diethyl ether , magnisium sulphate , sodium sulfate , thf , aq ammonium , isopropyl alcohol , potassium aceterate , eugenol , selenium powder , cesium carbonate , nitric acid , sulphuric acid , thionyl chloride , silicon oil , hydrogen peroxide , sodium chloride , sodium hydroxide , hexane , acetonitrile , ethanol , methanol , dichloromthane

CTN :42580306

10 Nov, 2025 NA

Aligarh - Uttar Pradesh

Tender For medicine supply for cow - supply of medicine, inj oxytetracycline la , 100ml, inj ceftrixone and tazobactum, 3375mg, inj pencillin, 2.5gm, inj amoxycilin + sulbactum, 4.5gm, inj gentamicin, 100ml, inj enrofloxacin 20%, 100ml, inj ceftriaxone, 3gm, bolus trimethoprim / sulfamethoxazole, 400mg+2000mg, inj meloxicam + paracetamol, 100ml, inj meloxicam, 100ml, inj tolfenamic acid, 30ml, inj vit-b complex, 100ml, inj vit-b complex with liverextract, 100ml, inj vit- b1,b6,b12, 100ml, inj methylcobalamin, 100ml, inj dexamethasone, 30ml, inj prednisolone acetate, 10ml, inj isoflupredone acetate, 10ml, inj calcium magnisium borogluconate, 450ml, injcalcium+vitamin-d3+methylcobalamin, 30ml, inj tranexamic acid, 50ml, inj ethamsylate, 30ml, inj epinephrine, 01ml, inj ascorbic acid, 30ml, inj tonophosphan sodium, 100ml, inj atropine sulphate, 10ml, inj frusemide, 10ml, inj ivermectin, 100ml, inj diminazene aceturate, 90ml, inj chlorpheniramine malleate, 100ml, inj valethamate bromide , 30ml, inj hydroxy progesterone acetate , 2ml, inj ringer lactate , 500ml, inj dextrose normal saline , 500ml, inj dextrose 10% , 500ml, inj normal saline , 500ml, inj cloprostenol , 2ml, inj buserelin acetate , 10ml, inj piroxicam , 100ml, inj diethylstillbestrol , 2ml, inj isometamediun cl. , 250mg, inj quinopyramine chloride and quinopyramine sulphate sulphate, 2.5gm, inj sodium biarbonate , 25ml, inj lignocanine , 30ml, inj xylazine, 30ml, inj propofol, 30ml, simethicone suspension, 100ml, bolus nitrofurazone +urea+povidine+metro tinidazole, 60mg+6000mg+60mg+100mg, hemostats forceps, bolus fenbendazole, 3000mg, bolus serratiopeptidase, spray antiseptic + antifungal, 100ml, antiseptic spray , 250ml, soln. ivermectin, 1lt., cypermethrin, 50ml, bandage 4 inch/6 inch, cotton bundle, 1kg, needle 16" 18" 20" gauze, surgical gloves latex, surgical suture needles straight/ round 100, al gloves 50 piece, butter fly-18", 22", 24" gauze, adhesive tape 3" , 50 piece, paper tape 1" , 50 piece, vicryl 2-0, 1-0, 100, 500m, liquid betadine ,500ml, pulv propoxur 2%, 100gm, terpentine oil, 100ml, powder propoxur 1% , 50gm, terramycin powder, 100gm, liquid paraffin, 100ml, boroglycerine, 10ml, boric acid, 100gm, zinc oxide, 100gm, potassium permagnate 1%, 200gm, liquid calcium/vitamin and mineral supplement, 5lt, iv drip stand stainless steel, irrigator douch can, 100ml, gum boot, tincture benzoin, 100ml, stainless steel dressing drum /autoclave drum, drenching pipe, casting rope for cattle, 9mt, apron reusable waterproof full sleeve, stainless steel tray with lid, stainless steel amputation saw with aluminium handle, artery forceps, inj. flunixin meglumine, 100ml, inj. methylcobalamine + vit. b6 + nicotinamide, 2ml, inj. polygeline + nacl + kcl + cacl, 500ml, rabies vaccine for animals, 01 ml x 10, bolus cu+cobalt+i+mn+selenium+zn+fe

CTN :42619779

27 Nov, 2025 NA

Delhi - Delhi

Tender For supply of zirconia reinforced glass ionomer cement for restoration , calcium hydroxide powder , white calcium hydroxide paste endodontic water based , edta paste , composite syringe nano filled , compoules for composite bulk fill , hand piece lubricating oil spray , rvg sleeves disposable , premix temporary cement zoe based , calcium hydroxide based cavity liner dycal or equivalent , sodium hypochlorite endodontic , bone graft tcp based tricalcium phosphate , putty based bone graft , endo access bur round safe ended , composite finishing yellow band bur tr 26ef ex 21ef fo22ef , metal cutting bur tungsten carbide , self sealing sterilization pouch 90x260mm , 300x400mm self sealing sterilization pouch , surgical bur number 702 and 703 , barrier film medical grade easy to remove should leave no residue , benzocaine gel 20 percent flavoured for intra oral use , c plus readysteel file 10 number 21 or 25mm , side vented endodontic irrigation needle , conc dot chlorhexidine flavoured for intra oral use calypso or equivalent , impression disinfection spray , retraction paste aluminium chloride based , local anaesthetic cartridge articaine , 30 gauge short needle for anaesthetic cartridge , 27g long needle for anaesthetic cartridge , dental stone type iii green , white dental plaster type 2 , impression paste , cold cure resin pink , temporary crown and bridge material bis acrylic composite based should be supplied with mixing tips and gun , cold mold seal , glass fibre splint , disposable endobloc autoclavable , bur holder 24hole autoclavable , bioactive dentine substitute , tofflemire retainer with matrix strips , retraction cord non impregnated , denture polishing kit acrylic contouring and finishing kit , tungsten cartridge bur for denture trimming , sx progressive taper rotary files 19mm , paeso reamers 32mm , fibre post refills translucent glass fibre , heat cure resin , sand paper mandrel , soft splint sheet , endodontic paper points f1 and f2 , single component light cure composite based temporary crown material , sectional matrix kit complete kit with matrices wedges ring tweezer forceps , all sizes of sectional matrix refills matrices , complete anterior kit for clear matrices including mesial distal diastema closure matrices wedges etc , clear matrices refills all types , disposable implant motor irrigation tubing for physiodispensar , pressure indicating paste polysiloxane based , endodontic use for mta , mta based root canal sealer , resin modified glass ionomer rmgi luting cement in clicker dispenser , liquid form resin modified glass ionomer luting cement in powder and , saddle matrix system , gp solvent for removal of gp and sealer , dental cotton rolls , burs composite finishing burs complete kit of aluminium oxide stone , composite finishing and polishing strips kit kit with strips coarse medium fine etc , nsk cartridge for air rotor handpiece compatible with , handpiece cartridge for airmotor , cartridge for endo-motor handpiece compatible with nsk

Central Government/Public Sector

CTN :42582739

25 Nov, 2025 NA

Ropar - Punjab

Tender For tender for supply of lab chemical d d - ammonium persulphate detailed as per annexure , buffer tablet 4.01 20 tablet in one pkt detailed as per annexure , buffer tablet 9.01 20 tablet in one pkt detailed as per annexure , buffer tablet 7.01 20 tablet in one pkt detailed as per annexure , chromotropic acid detailed as per annexure , chlorotex detailed as per annexure , devard s alloy detailed as per annexure , ethyl alcohol detailed as per annexure , hydrogen peroxide 30 percentage detailed as per annexure , methanol ar/gr specially dried detailed as per annexure , metol detailed as per annexure , methanol hplc 2.5lt detailed as per annexure , pyrogallol detailed as per annexure , potassium hydroxide detailed as per annexure , potassium metabisulphite detailed as per annexure , sulphuric acid detailed as per annexure , toluene detailed as per annexure , universal detailed as per annexure , sodium sulphite detailed as per annexure , acetone ar detailed as per annexure , n-hexane detailed as per annexure , potassium sulphate detailed as per annexure , pdab/p-dimethylaminobenzaldehyde detailed as per annexure , mercuric chloride detailed as per annexure

Private Sector

CTN :42590487

13 Nov, 2025 2.53 Crore

Multi City - Karnataka

Tender For corrigendum : short term re tender for procurement of raw materials required for production of 2k pu paints & synthetic enamel paints and allied products for the year-2025-26.for .06 months contract. - bleached lac, bleached lac, bysaki seed lac, bysaki seed lac, chlorub-20, chlorub-20, benzoyl peroxide paste, benzoyl peroxide paste, gilsonite, gilsonite, beta blue, beta blue, tinuvin 1130 / eversob 80 / uvasorb k-289, tinuvin 1130 / eversob 80 / uvasorb k-289, additial vxl 5918 equivalent xynogel k-170, additial vxl 5918 equivalent xynogel k-170, byk 163 / afcona 4071 / tego dispers 671, byk 163 / afcona 4071 / tego dispers 671, byk 333 / afcona 3251 / tego glide 450 / sloxka k-220, byk 333 / afcona 3251 / tego glide 450 / sloxka k-220, byk w 980 / afcona 5251 / w & d 890, byk w 980 / afcona 5251 / w & d 890, byk 358 n / afcona 3670 / addiol xl 480 / levelon k 767, byk 358 n / afcona 3670 / addiol xl 480 / levelon k 767, byk 410 / afcona antil 312 / thixotron k 412, byk 410 / afcona antil 312 / thixotron k 412, hostaperm pink, hostaperm pink, ultramarine blue, ultramarine blue, synthetic yellow oxide, synthetic yellow oxide, toluedine red, toluedine red, sumica luminous gold 41634, sumica luminous gold 41634, signal red, signal red, s.f. yellow g, s.f. yellow g, rubine toner, rubine toner, prussian blue, prussian blue, aluminium paste (leafing grade), aluminium paste (leafing grade), aluminium paste ss-3000, aluminium paste ss-3000, sudafast green - 2727, sudafast green - 2727, sudaperm yellow - 2903, sudaperm yellow - 2903, sudafast blue - 2662, sudafast blue - 2662, sudaperm blue 2796, sudaperm blue 2796, novaperm orange 2915, novaperm orange 2915, novaferm red f5rk / sudaperm red 2967 / amcron fast red k 4170, novaferm red f5rk / sudaperm red 2967 / amcron fast red k 4170, scarlet chrome / sudadurorange 1475, scarlet chrome / sudadurorange 1475, middle chrome yellow, middle chrome yellow, carbon black n 330, carbon black n 330, stand oil 4 poise, stand oil 4 poise, pale dco / dco monomeric, pale dco / dco monomeric, alkyd refined linseed oil (arlo), alkyd refined linseed oil (arlo), bitumen/maxphault 90/15, bitumen/maxphault 90/15, coaltar pitch solution 55.35, coaltar pitch solution 55.35, micro soap stone powder, micro soap stone powder, white barytes, white barytes, micro red oxide powder, micro red oxide powder, red oxide powder 300 mesh, red oxide powder 300 mesh, ace whiting, ace whiting, smectone clay, smectone clay, micro talc powder, micro talc powder, micro silica powder, micro silica powder, graphite, graphite, forcal u, forcal u, forcal s, forcal s, china clay (white), china clay (white), micro baryters, micro baryters, super snow white baryters, super snow white baryters, titanium dioxide tio 2 rutile rc 822, titanium dioxide tio 2 rutile rc 822, dbtl, dbtl, zinc napthanate 6%, zinc napthanate 6%, nilset 117/ fineset 35, nilset 117/ fineset 35, manganease octoate, manganease octoate, lead octoate 18%, lead octoate 18%, cobalt octoate 6%, cobalt octoate 6%

Central Government/Public Sector

CTN :42270203

10 Nov, 2025 16.98 Lacs

Bhimtal - Uttarakhand

Tender For corrigendum : supply of custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5 gcggtgaagtgctcagttccc 3 22 nucleotides , ipn f 5 gtgctggccacaacgacaac 3 21 nucleotides , ipn r 5 aattggtctgccgttccta 3 19 nucleotides , isaoic f 5 ggctatctaccat aacgaat 3 21 nucleotides , isaoic r 5 gccaagtgtaagtgcactcc 3 21 nucleotides , bench top 1kb dna ladder , bench top 100bp dna ladder , bench top pcr marker , taq dna polymerase recombinant 5u ul , quick cip 1000 units with buffer , t4 dna ligase 20000 units , protoscript ii first strand cdna synthesis kit 30 reactions , q5 high fidelity 2x master mix 100 reactions , onetaq 2x master mix with standard buffer 100 reactions , synthetic peptides , spectradrop 24 kit , easy yeast plasmid isolation kit 50 rxns , quick easy yeast transformation mix 20rxn , western blot immuno booster pf 250ml , western blot blocking buffer protein free 500ml , fastdigest apai 300rxn , fastdigest bamhi 800rxn , fastdigest bgiii 100rxn , fastdigest ecori 800rxn , fastdigest ecorv eco32i 200 rxn , fastdigest hindiii 800rxn , fastdigest kpni 300rxn , fastdigest ncoi 20rxn , fastdigest ndel 100 rxn , fastdigest nhel 50 rxn , fastdigest notl 50 rxn , fastdigest saii 200rxn , fastdigest smai 100 rxn , fastdigest saci 100 rxn , fastdigest xbai 300 rxn , fastdigest xhoi 400 rxn , fastdigest value pack , synthetic peptide , mrgsh 011fw , mrgsh 011rv , shrv 1 f , shrv 1 r , shrv 2 f , shrv 2 r , shrv ipc2 fwd , shrv ipc2 rev , bacterial genome sequencing

Central Government/Public Sector

CTN :42568485

24 Nov, 2025 NA

Hamirpur(Hp) - Himachal Pradesh

Tender For supply of chemicals d d - round bottom flask 100 ml b 19 , clicklok micro centrifuge tube 5ml 100 per pack , clicklok micro centrifuge tube 2ml 500 per pack , clicklok micro centrifuge tube 1 point 5 ml 500 per pack , tips 1000 microlitre 500 per pack , tips 20 to 200 microlitre 1000 per pack , tips 20 microlitre 1000 per pack , parafilm 4 inch by 125 feet roll , tissue paper roll , dichlromethane dcm 2 point 5 ltr , ethanol 500 ml , 4 diethylamino salicylaldehyde 25 gm , 3 comma 5 di tertbutyl 2 hydroxybenzaldehyde 5 gm , capillary both end open 75mm , sodium sulphate anhydrous 500 gm , silica gel 60 to 120 mesh 500 gm for column chromatography , guard tube b 19 , chlorotrimethylsilane 25 ml , 3 aminopropyltriethoxysilane 100 ml , diethyl ether 2 point 5 litre , suberohydroxamic acid greater than equal to 95 percent 1gm , 3 fluorobenzaldehyde greater 97 percent 5ml , 2 nitro acetophenone 05 gm , round bottom flask 25ml b 19 , 3 chloropropyl triethoxysilane 100 ml , chloroform 2 point 5 ltr , phenyl l alanine 50 gm , dmso 01 ltr , berberine chloride 5 gm , acetone 05 ltr , ethyl acetate 2 point 5 ltr , vanillin greater than equal to 99 percent 500 gm , cystamine dihydrochloride 97 percent 100 gm , diphenyl 2 comma4comma 6 trimethylbenzoyl phosphine oxide tpo greater than 98 percent 25 gm , 2 ethyl 4 methyl imidazole emi greater than 95 percent 100 gm , 1comma 6 hexanediol diacrylate hdda greater than 80 percent 100 gm , zinc acetate dihydrate purity 99 point 1 percent 250 gm , polyethylene glycol 100 gm , florine doped tin oxide fto 75mm by 25mm by 2point2 mm ohm per square pack of 2 , zinc nitrate hexahydrate 500 gm , 2 methoxyethanol 250 ml , ethanolamine 250 ml , methenamine 500 ml , sodium tungstatedihydrate 250 gm , sodium nitrate 100 gm , cetyltrimethylammoniumbromide 100 gm , n pentanol 500 ml , sodium sulphate 250 gm , indium tin oxide ito 20mm by 20 mm less than equal to 10 ohm per square pack of 25 , polyvinyl butyral pvb 100 gm , polyvinyl alcohol pva 100 gm , polyvinylidene fluoride pvdf 25 gm , n methyl 2 pyrrolidone nmp 500ml , nickel foam 1 point 5 mm thickness 200mm by 300mm , acetylene black 100 gm , zinc nitrate dehydrate 500 gm , hexamine 500 gm , trisodium citrate dehydrate 500 gm , phosphoric acid 1 ltr , urea solution 100 ml , diethyl formamide 100 ml , terephthalic acid 500 gm , zirconium tetrachloride 50 gm , ethylene glycol 250 gm , conducting carbon fiber cloth 200 mm by 200 mm , 2 aminoterephthalic acid 25 gm , fumaric acid 500 gm , 2 methylimidazole 250 gm , 1 comma 3 comma 5 benzenetricarboxylic acid 100 gm , cupric nitrate 500 gm , round magnetic stirrer bar with pivot ring 9 point 5mm by 30mm pack of 10 , beaker 100 ml , beaker 50 ml , aluminium foil 20 microns 1kg , spatula 6 inch one side spoon oneside flat , measuring cylinder 100 ml , polymethyl methcrylate 25 gm , polypropylene 50 gm , polyethylene 100 gm , cholesterol 97 percent extra pure 25 gm , triton x 100 for molecular biology 100 ml , gallic acid pure 98 percent 100 gm , carboxymethyl cellulose sodium salt 500 gm , polysorbate 20 tween 20 for molecular biology 100 gm , tannic acid extrapure 100 gm , quinine sulphate greater than gr 99 percent 25 gm , brij 30 500 ml , poly lactic co glycolic acid plga 01 gm , polystyrene powder 1 kg , oleic acid extra pure 500 ml , chitosan 25 gm , gelatin powder 1kg , beta nicotinamide adenine dinucleotide phosphate tetrasodium salt reduced beta nadph na4 extrapure 98 percent 25 mg , thiazole orange 250 mg //bid details 2 / 53

CTN :42334710

07 Nov, 2025 NA

Udyogamandal - Kerala

Tender For corrigendum : tender for supply of laboratory chemcials : - calcium carbonate ar, hydrochloric acid. grade: ar/gr (pack.2.5 l, pottassium bromide ar, sodium molybdate ar, sulphuric acid.grade: ar/gr/er, cyanide standard solution, traceable to srm from nist., cyanide concentration: 1000mg/litre, salicylic acid lr, pyrogallol. grade: lr., ph buffer capsules (ph 4.0±0.05) pack containing, ph buffer capsules (ph 9.2±0.05) pack containing, ammonium acetate, grade: ar/gr, ammonium chloride, grade: ar/gr, ammonium fluoride ar/gr, ammonium molybdate-ar, boric acid, grade: ar/er/gr, ph paper, 2 to 10.5, 10 books in a packet, book containing 20 leaf each with colour chart in every book, ph buffer capsules (ph 7.0±0.05) pack containing, phenolphthalein indicator powder, grade lr, in containers of 50g, paraffin liquid.grade: ar/gr, phosphorous pentoxide.grade: ar/er/gr, sodium bicarbonate.grade: ar/gr, sodium hypochlorite containing 5-6% available chlorine, cadmium acetate dihydrate ar, minimum assay 9, ammonium hydroxide<(>,<)>, concentration: 25%, sp.gravity: 0.91, max limits of impurities: 0.01% non, volatile matter.chloride as, cl, :0.001% sulphate as so4: 0.002% arsenic as, as: 0.00002% iron as fe, :0.0001% lead as pb: 0.0001%, charcoal-activated, mono ammonium phosphate (map) 12:61:0, (100% water soluble), fertiliser grade conforming to fco.

Central Government/Public Sector

CTN :42506769

20 Nov, 2025 5.32 Lacs

Hazaribag - Jharkhand

Tender For supply of acetonitrile lr grade , acetocarmine stain , acetone mb grade , acetic acid , adenosine triphosphate atp disodium salt , agarose low melting point , aluminium chloride hexahydrate , aluminium chloride powder mb grade , ammonium chloride ar grade , ammonium dihydrogen phosphate ar grade , ammonium vandate , ammonium fluoride , amylose standard 99 pure , amylopectine standard 99 pure , ampicillin 10g , ammoniasolution extra pure ar 25 minimum , 1 napthol , anthrone reagent , anza 5 bamhi , anza buffer set , anza 11 ecori , anza 16 hindiii , aniline blue stain , benzene lr grade , beta nadph , 2 2 bipyridyl , boric acid , bovine serum albumin , 5 bromo 4 chloro 3 indolyl , butylated hydroxytoluenebht exiplus multi compendial 99 , calcium chloride anhydrate ar grade , calcium nitrate tetrahydrate ar grade , calcium oxide , carbinol lr grade , chitosan oligosaccharide , chloroform 95 lr grade , chloroform isoamyl alcohol 24 1 500ml , coomasie brilliant blue g 250 , concentrated hydrochloric acid hcl 35 pure , cupric sulfate pentahydrate , diethyl ether lr grade , dichloromethane , dimethyl sulphoxide dmso hi lr , dinitrosalicylic acid reagent dnsa , diluent for nucleic acid extraction , dithiothreitol , di sodium hydrogen phosphate dihydrate 1kg , depc , dipyridyl reagent or 2 2 bipyridine , 2 7 dichlorodihydrofluorescein diacetate dcfh da , 3 3 diaminobenzidine dab pure , 5x t4 dna ligase buffer , 6x dna loading dye triple dye , dntp set 10mm 2 5mm each , dnph 2 4 dinitrophenyhydrazine reagent grade , 2 4 epibrassinolide , edta disodium salt dihydrate hi ar acs , ethanol 99 ar grade , ethyl acetate lr grade , ethidium bromide 10 mg ml , ethylene glycol lr grade , fe hydroxyethylenediaminetriacetic acid fe hedta , ferric chloride hexahydrate reagent grade , fecl3 , formaldehyde lr grade ) /bid number : gem/2025/b/6819034 * /dated: 30-10-2025 & & / bid document 1 / 39

Pyrogallol Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

State Government

Central Government/Public Sector

Private Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector