Latest pyrogallol Tenders | Government pyrogallol Tenders

Central Government/Public Sector

CTN :40025038

07 May, 2025 4.20 Lacs

Sambalpur - Odisha

Tender For supply of lab equipment - charts , models , slide permanent , specimens , pictures posters charts , beaker , dropping bottle , forceps , funnel , micro viewers , microscope , petri dish , pipette , skeleton , test tube holders , test tube stand , watch glass , water bath , wash bottle , burette , capillary tube , thermometer , ammonium solution , chromatography paper , formaldehyde , glycerine , robert solution , micro cover slip , micro glass slides , millions reagent , needle , nitric acid , sucrose , test tube ordinary , ph paper , blade for section cutting , acetic acid , brushes , blow pipe , burette stand , test tube brush , cork borer , cork presser , crucible tongs , charcoal slab borer , crucible , deflagrating spoon , distilation apparatus , drying cones , funnel stand or filter stand , pestle and mortar , pinch cock , retort stand , round file , sand bath , spirit lamp , test tube stand , test tube holder , triangular stand , tripod stand , trough , wire gauze , triangular clay pipes , beehie sheft , burettle , china dish , conical flasks , dessicator , gas jar dises , flasks , gas jar or cylinder , glazed tile , measuring flasks , retort , thistle funnel , woulfes apparatus , watch glass , ammonium carbonate , ammonium chloride , ammonium sulfate , ammonium bromide , aluminum sulfate , iron sticks , potassium nitrite , ammonium oxalate , sodium thiosulphate , zinc sulfate , cobalt nitrate , sodium hydroxide , copper sulfate , potassium nitrate , oxalic acid , magnesium sulfate , magnesium chloride , ammonium phosphate , sodium chloride , potassium ferrocyanide k4fe cn 6 , ferrous sulfate , sodium bromide , ammonium ferrous sulfate , potassium dichromate , barium chloride , strontium nitrate , sodium sulphide , potassium chromate , lead acetate , sodium sulfate , potassium iodide , lead nitrate , cedric ammonium nitrate , 2,4 dnp , universal indicator , ammonia solution nh4oh , phenol , aniline , bromine water , acetaldehyde , fehling solution a b , acetone , carbon disulfide , phenolphthalein , nesslers reagent , ammoniumm olybdate , nickel carbonate , nickel sulfate , manganese chloride , calcium chloride , sodium bisulphate. , cobalt acetate , chloroform , magnesium ribbon , zinc granual , lead nitrate pb no3 2 , potassium iodide ki , lead metal pb , ethyl acetate , sodium metal , pottasium permanganet kmno4 , pottasium dichromate k2cr2o7 , hydro chloric acid hcl , sulphuric acid h2so4 , nitric acid hno3 , ethanol , test tube , test tube holder , dropper glass , filter paper , glass rod , sodium sulfite , picric acid , borax , cobalt glass , aluminum metal , spatula , laboratory thermometer , drawing board , friction apparatus complete set with weight box , parallelogram apparatus , helical spring apparatus with weights , resonance apparatus , spherometer , screw gauge , wooden scale , stopwatch , sonometer set , sprit level , vernier calliper , beakers , connecting wires , concave mirror , convex mirror , convex lens , concave lens , glass slab , pendulum bob , cork rubber , hanger weights , metalic bob , slinky spring , spring balance , copper calorimeter , wave pendulum , barometer tube , lactometer , proof plane , boyles law apparatus , fortnis barometer , metallic cylinders brass , metal sphere , youngs modulus apparatus , hydrometer , tunning fork , rubber pad , copper sulphate bid details/ 2 / 142

CTN :39925929

16 Apr, 2025 6.54 Lacs

Ganganagar - Rajasthan

Tender For supply of lab chemicals at sstps(o and m),suratgarh.-, 1-amino-2-naphthol-4- , , sulphonic acid (1 pkt = 25 gm) , , ammonium chloride (1 pkt =500gm) , , ammonium molybdate tetrahydrate (1 pkt=500 gm) , , ammonium perpurate (1 pkt=5gm) , , acetone (1pkt= 500 ml) , , ammonia solution 25% (1 pkt=2.5 itr) , , acetic acid (1pkt= 2.5 ltr) , , bromo cresol green 0.04% indicator ph 3.6-5.2 yellowish-green (1pkt= 125 ml) , , bleaching powder (1 pkt =500 gm) , , conc. hydrochloric acid (1 pkt=500ml) , , chlorotex reagent (1 pkt =100 ml) , , diethyl ether (01 pkt=500 ml) , , ethanol (1 pkt =500 ml), , , etylene diamine tetra acetic acid disodium salt dihydrate (1pkt= 500gm) , , eriochrome/solochrome black -t (1pkt= 25gm) , , glycerol anhydrous (1 pkt =2.5 ltr) , , 1 n hydrochloric acid ampule (1 pkt= 06 no's) , , hexamine (1 pkt = 500 gm) , , hydroxyl amine hydrochloride (01 pkt=500 gm) , , isopropyl alcohol (1pkt= 2.5ltr) , , n/10 lodine ampule (1 pkt = 06 nos.) , , lead nitrate (1 pkt = 500 gm) , , methanol (1 pkt =2.5 ltr) , , methyl red 0.01% indicator solution ph 4.3-6.3 red-yellow (1pkt= 125 ml) , , mercuric thio cyanate (1 pkt= 100gm) , , nessler reagent (1 pkt = 100 ml) , , nitric acid (1 pkt= 2.5 ltr) , , oxalic acid (1 pkt =500 gm) , , o-toludine (1pkt= 500gm) , , para dimethyl amino benzaldehyde (1 pkt =500 gm) , , potassium hydroxide pellets (1 pkt =500 gm) , , e , , pyrogallol (1 pkt =100 gm) , , 1,10 phenenthroline (1pkt=5gm) , , phenophthalein indicator (1 pkt =125 ml), , , ph indicator paper (ph 1.0-14.0) with colour scale , , sodium meta bisulphite (1 pkt =500 gm), , , sodium sulphite (1 pkt =500 gm), , , sulphuric acid (1 pkt =2.5 ltr) , , sodium acetate (1pkt= 500gm) , , sodium hydroxide pellets (1pkt= 500gm) , , starch soluble (1pkt=500gm) , , n/10 sodium thio sulphate ampule , , silicone high vaccum grease (lab) (1pkt= 50 gm) , , 1 n sodium hydroxide ampule (1 pkt = 06 nos.) , , sodium potassium tartarate (1pkt=500gm) , , silver nitrate (01 pkt=100 gm) , , standard silica (1000 ppm) (1 pkt=500 ml) , , toluene (1pkt= 2.5 ltr) , , universal indicator ph 4-11 indicator with colour chart (1 pkt =500 ml), , , xylene (sulphur free) (1 pkt= 2.5ltr) , , xylenol orange indicator(01 , , pkt=10 gm) ,

CTN :39905846

05 May, 2025 NA

Rishikesh - Uttarakhand

Tender For tender for procurement of various consumables for department pathology and lab medicine - tissue embedding plastic cassettes, trimming blade (130mm), trimming blade (260mm), cryostat gel, microtome blades, low profile, microtome blades, high profile, absolute alcohol, cover slips 22mmx50mm, cover slips 22mmx22mm, rpmi medium, michel transport media, slide labels, filter cards for cytospin, paraffin wax, formalin, double frosted glass slides, embedding cassette permanent marker, dpx mounting medium, haematoxylin stain powder, gold chloride, giemsa stain powder, silver nitrate powder, mgg (may grunwald giemsa powder), edta acid free, xylene, acetone, papanicolaou stain ea50, papanicolaou stain ea36, papanicolaou stain ea65, papanicolaou stain2b orange, filter paper, cedar wood oil, tissue roll for microscope, nitric acid, schiff s reagents, micropipette tips 10ul , micropipette tips 200ul , micropipette tips 1000ul, egg albumin powder, ammonium sulphate, slide tray aluminum (20 slide capacity), acid fast stain kit (afb), methanol, picric acid, periodic acid, giycerine, cytochrome stain kit, slide storage box (100 slide capacity), reticuloyte counting fluid, neubauers chamber

CTN :39905856

24 Apr, 2025 NA

Rishikesh - Uttarakhand

Tender For tender for procurement of surgical consumables-, tissue embedding plastic cassettes , trimming blade (130mm) , trimming blade (260mm) , cryostat gel , microtome blades, low profile , microtome blades, high profile , absolute alcohol , cover slips 22mmx50mm, rpmi medium , michel transport media , slide labels , filter cards for cytospin , paraffin wax , formalin , double frosted glass slides , embedding cassette permanent marker , dpx mounting medium , haematoxylin stain powder , gold chloride , giemsa stain powder , silver nitrate powder , mgg (may grunwald giemsa powder), xylene , acetone , papanicolaou stain ea50 , papanicolaou stain ea36 , papanicolaou stain ea65 , papanicolaou stain2b orange , filter paper , cedar wood oil , tissue roll for microscope , nitric acid , schiff's reagents , micropipette tips 10ul , micropipette tips 200ul , micropipette tips 1000ul , egg albumin powder , ammonium sulphate , slide tray aluminum (20 slide capacity) , acid fast stain kit (afb) , methanol , picric acid , periodic acid , giycerine , cytochrome stain kit , slide storage box (100 slide capacity) , reticuloyte counting fluid , neubauers chamber

CTN :39896985

24 Apr, 2025 NA

Silvassa - Gujarat

Tender For supply of laboratory materials - cotton swab with wooden stick , autoclavable disposable bag , h2s test strip modify for water testing , blood culture bottle with bhi adult , blood culture bottle with bhi pediatric , aluminum foil , disposable petridish , ast n405 , ast gp 628 , ast n406 , ast st 03 , ast yeast ast y508 , autoclavable pipette , autoclavable pipette tips , cryotubes 1.8ml , early ns1 elisa for dengue , early igm elisa for dengue , gn test kit vtk2 , gp test kit vtk2 , hepatitis a rapid , hepatitis e rapid , leptospira igm elisa igm , suspension solution , unsensitised tube , uricol , vibrio cholerac antisera , yst test kit vtk2 , sterile cotton swab in polypropylone , hiv elisa , hbsag igm elisa , hcv igm elisa , loop holder , sterile disposable petridish , anerogen pack , macconkey agar , peptone, bacteriological , s s agar selective agar , sabouraud dextrose agar , susceptibility test amikacin , susceptibility test ampicillin , susceptibility discs aztreonam , susceptibility discs cefepime , susceptibility discs ceftazidime , susceptibility test ceftriaxone , susceptibility test gentamycin , susceptibility discs imipenem , susceptibility discs netilmi , susceptibility test ofloxacin , susceptibility discs vancom , susceptibility discs nitrofur , susceptibility amoxyc , susceptibility ciproflo , susceptibility cefotaxiom , susceptibility tetracycline , susceptibility doxycycline , susceptibility levofloxacin , susceptibility clindamycin , susceptibility linezolide , susceptibility cefoperazone , susceptibility meropenam , susceptibility piperacillin , susceptibility cefazoline , susceptibility cefuroxime , susceptibility cefixime , susceptibility colositin , susceptibility chloramphenicol , susceptibility fosfpmycine , co- trimoxazole sulpha , high level gentamicin , polymixin b , susceptibility ketoconazole , susceptibility nystatin , susceptibility fluconazole , susceptibility amphotericin , susceptibility itraconazole , susceptibility miconazole , susceptibility clotrimazole , susceptibility novobiocin , susceptibility bacitracin , susceptibility optochin , oxidase discs , muller hinton agar , simmons citrate agar , triple sugar iron , phenylalanine agar , indian ink , kovac iodole regaent , cover slip , whatmans filter paper , metaloop ch2 , nichrome loop-d-1 , test tubes , zn stain , corn meal agar , potato dextrose agar , trichophyton agar 1 , trichophyton agar 2 , trichophyton agar 3 burners , sulphosalicylic acid , fouchet reagent ready to use , ehrlichs aldehyde , benzidine powder, hydrogen peroxide solution , hutchisons student spirometer , hot air oven , jaeger chart for near vision, snellen chart for far vision , distilled water, abo blood group antisera kit , rbc diluting fluid bottle, wbc pipette, rbc pipette, n10 hci , surgical spirit , tooth prick stick bundle , watch glass, round filter paper box , small size dropper, cedar wood oil , lancet box , beaker , potassium permaganate, pink filter paper big size, glass starrier for hb , glucose kit , total protein kit , albumin kit , cholesterol kit , urea kit , hdlc kit , triglycerides kit, tbil dbil kit , calcium kit , inorganic phosphorous kit , ast kit , alt kit , alp kit , micropipette , sulphur powder , sodium chloride , acetone , sodium hydroxide pellets, phenolphthalene , silver nitrate , sodium nitroprusside , potassium hydroxide , methylene blue reagent , bilirubin powder , bovine albumin, egg albumin , urea , sodium taurocholate , methanol , conc. hn03 , conc. hcl , ammonium hydroxide , picric acid semisolid , creatinine powder , eppendorf tubes , ph paper strip, stainless steel spatula , stainless steel spatula , beaker low form with spout , beaker low form with spout , plastic bid details/ 2 / 169

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Pyrogallol Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector