Thiobarbituric Acid Tenders

Get complete information related to latest Thiobarbituric Acid Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Thiobarbituric Acid Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Thiobarbituric Acid Tenders .

Filter

Loading....

Get Tender in Email

CTN :39730641

18 Apr, 2025 NA

Ambala - Haryana

Tender For bid to ras bid to ras bid to ras supply of tab daclatasvir 60mg , tab cyproheptadine 4mg , tab carbamazepine cr 200mg , tab rizatriptan 5mg , tab rifampicin 600mg plus isoniazid 300mg , ung clindamycin phosphate gel tube of 10gm , terbinafine 1 percent cream tube of 10gm , para dichlorbenzene 2 percent benzocaine 2 point 7 percent chlorbutol 5 percent turpentine oil 15 percent bott of 10ml , 2-propanol 45gm 1 propanol 30gm ethyl hexadecyl dimethyl ammonium ethyl sulphate 0 point 2gm with skin protecting substances 500 ml bott with dispenser , tab acetazolamide 250mg , pulv l ornithine l asparate pkt of 5gm , tab secnidazole 1gm , tab tacrolimus 0 point 5mg , acyclovir ophth ointment 3 percent w w in 5 gm tube , clotrimazole 1 percent plus lignocaine 2 percent bott of 10ml ear drop , salmeterol 25 mcg plus fluticasone 125 mg mdi 120 doses , tab lamivudine 150mg , ung clindamycin 1 percent adapalene 0 point 1 percent 15 gm , ung clobetasol propionate 0 point 05 percent plus salicyclic acid 3 percent 20gm , desonide 0 point 01 percent cream 10gm , ung eberconazole 30gm , ung moxifloxacin 0 point 5 percent for opthalmic use tube of 5 gm , ung polymycin b sulphate 5000units plus bactricin 400units plus neomycin sulphate3400units 20gm , ung tacrolimus 0 point 1 percent 10gm , lot chlorhexidine gluconate 4 percent bott of 500ml , lot clobetesal 0 point 05 percent salycyic acid 3 point 5 percent tube of 30ml , lot clotrimazole 1 percent plus beclomethasone 0 point 025 percent bott of 15 ml , lot lacquer nail amorlfine 5 percent 2 point 5ml , lot minoxidil 2 percent bott of 120ml , n acetyl cysteine nebulising solution 20 percent 5 ml , nasal spray azelastine 0 point 1 percent bott of 10ml , nasal spray mometasone 50 mcg puff 10 ml , pulv calcium polysterene sulphonate k binder sachet , pulv glutamine sachet , pulv l arginine sachet , pulv neomycin plus polymixin b bott 10gm , pulv pre probiotic , syp disodium hydrogen citrate bott of 100ml , syp ibuprofen plus paracetamol bott of 60ml , tab acarbose 25mg , tab acelofenac plus paracetamol plus chlorxazone , tab acenocoumarole 2mg , tab acotiamide 100mg , tab alprazolam 0 point 5mg , tab amisulpride 50mg

CTN :40025598

06 May, 2025 NA

Silvassa - Gujarat

Tender For supply of cap deferiprone 500mg , cap danazol 200 mg , cap nifedepine 5mg sl , tab ascorbic acid 200mg plus sod ascorbate 338mg , tab azathioprine 25 mg , tab deferasirox 500 mg , tab imipramine25mg , tab lithium carbonate 300mg , tab lithium carbonate 450mg , tab meclizine hydrochloride 25mg , tab methylphenidate 10mg , tab methylphenidate 5mg , tab mifepristone 200mg misoprostol 200mcg , tab mosapride 5mg , tab oxcarbazepine 450mg , tab piracetam,vinpocetine and ginkgo biloba extract rinbuz , tab pyridostigmine 60mg , tab sulfamethoxazole 400 plus trimethoprim 80 ss , tab sodamint , tab sumatriptan 85mg plus naproxen 500mg , tab tetrabenazine 25mg , tab warfarin 5 mg , tab cariprazine 3 mg , tab opipramol 100 mg , tab tadalafil 10 mg , tab clomipramine 25 mg xr extended realese , tab clomipramine 50 mg xr extended realese , tab amisulpride300mg , suppositories glycerine 2 gm , suppositories paracetamol 170 mg , cream cetrimide 1 125 wor w plus calamine 1 5 wor w plus dimethicone 20 wor w plus zinc oxide 7 5 wor w 20mg , cream fluocinolone acetonide 0 025 20gm , cream hydrocortisone 0 25wor w and crotaminton10 wor w , cream tacrolimus 0 03 , cream lidocaine 1 5 wor w plus nifedipine 0 3 wor w , drop betamethasone and neomycine earor eye drop , drop mefenamic acid 15ml , drop pilocarpine 2 eye 5ml , drop vitamin e 50mgor ml 15ml , cream zinc oxide , gel nuprep skin prepration gel 4 oz , mapiform silicon sheet , oil simyl mct 50ml , oint atropine sulphate 1 eye ointment 3gm , oint calcitriol 0 0003 wor w , oint ciprofloxacin eye ointment 5gm , powder gloves 1 kg , powder sodium chloride and sodium bicarbonate sachet for nasal wash niti wash , sachet racecadrotil 10mg , sol boric acid or boro spirit 500ml , sol chloroxylenol i p 4 8 wor v terpinelol b p 9 0 vor valcohol absolute 13 1 vor v 500ml , sol dubecco s modified eagle medium solution 100ml dmem , sol ether 500ml , sol glycolic acid 25 solution 60ml , sol glycolic acid 50 solution 60ml , sol haemocoagulase 0 2 cu 10ml , sol ipratropium bromide 30ml , sol liquid parafin 400ml , sol melas peel kh 60ml , sol salicyclic acid 25solution salipeel alcoholic solution 60ml , sol salipeel ds 30 solution 60ml , sol tca peel 25 solution 60ml , sol tca peel 35 solution 60ml , sol trypsin edta solution 100ml , sol xylocaine viscous 100ml bid details/ 2 / 63

CTN :39481966

09 May, 2025 NA

Dehradun - Uttarakhand

Tender For corrigendum : supply of veterinary allopathic medicines - albendazole bolus (1500 mg), albendazole bolus (3000 mg), albendazole susp. (2.5%w/v), albendazole susp. (5% w/v), albendazole + clorsulon bolus (1.25 g + 70 mg), albendazole + ivermectin bolus (1500 mg+ 100 mg), amitraz susp. (12.5% w/v), amprolium hcl + vitamin k3 (20% w/w+2mg as sodium salt), antimony pot. tartrate +ferrous sulpate +cu so4.+co cl.bolus (2gm+2gm+50mg+100mg/ bolus), atropine sulphate ip (1mg/ml ), bolus ciprofloxacin + tinidazole (1500 mg +1800 mg /bolus), benzoic acid ip 5% w/w + boric acid ip 4.5% w/w + salicyclic acid ip 3.5% w/w+ zinc oxide ip 4.5% w/w + sulphur ip 1% w/w, calcium borogluconate+ magnesium phosphate+ dextrose anhydrous (1.86% + 5% + 20%), cefuroxime sodium (250 mg/ 3.5 g syringe), cephalexin + neomycine sulph. + prednisolone (100 mg+100 mg+ 10 mg), cephalexin powder (7.5 % w/w), chloramphenicol eye ear drops (5%), chlorhexadine gulconate+cetrimide sol. (7.5%+15%w/v), cholistine sulphate powder (100 gm), ciprofloxacin + tinidazole i/u susp.(each 5 ml contains 125 mg+150 mg), clomiphene tab & copper sulphate fertility kit(500 mg clomiphene 1tab + 750 mg copper sulphate 2 tab), clorsulon + ivermectin + exipi. qs susp.(10 mg+ 10 mg /ml), closantel bolus (1gm), colistin sulphate+cloxacillin sodium (500000 iu + 200 mg), cyperheptadine hcl + cocl + vit.b1, b6, b12 (25 mg + 100 mg + 50 mg + 50 mg + 500 mg), cypermethrin high cis(12% w/v), cypremethrine high cis+ ethion solvent (12% w/v, 8% w/v qs), deltamethrin solution (1.25% w/v), dried aluminium hydroxide+ magnesium hydroxide + activated dimethicone (600 mg + 250 mg + 50 mg / 5 ml), dried aluminium hydroxide+ simethicone + sorbitol solution (70%)+ dill oil+ suspension base (600mg+300mg+400mg+100mg+50mg), enrofloxacin susp. (10%), fenbendazole + ivermectin bolus (3 g + 100 mg), fenbendazole + oxyclozanide bolus (1gm+ 800 mg), fenbendazole + rafoxanide bolus (2gm+3gm), fenbendazole bolus (1500 mg), fenbendazole bolus (3000 mg), fenbendazole susp. (10%), flumethrin solution (1%), furazolidone + metranidazole (500 mg+ 1000 mg / bolus), gamma benzene hexachloride + cetrimide+ proflavin hemisulphate+ eucalyptus oil + turpentine oil as base, gentamicin+clotrimazole+ betamethasone (0.3% w/w+1.0% w/w +0.02% w/w) eye/ ear drops, gluteraldehyde + didecyl dimethyl ammonium chloride + benzalkonium chloride ( 11.00 g + 8.18 g + 17.85 g) / 100 ml isopropyl alcohol & pine oil as excipient, hypochlorous acid (135 mg/l), inj ceftiofur sodium, inj ranitidine (50 mg/2ml) usp, inj. prednisolone acetate ip 10mg/ml, inj. ringer lactate, inj. tylosin (20%), inj. analgin (50 mg/ml), inj. amikacin sulphate (250 mg/ml), inj. amoxycillin sodium + tazobactum (3000 mg + 375 mg), inj. ampicillin (3 gm), inj. ampicillin + cloxacillin (1500 mg+ 1500 mg), inj. ampicillin+ cloxacillin (500 mg+ 500 mg), inj. b1+b2+b6+b12+ liver extract (10 mg+5 mg+100 mg+30 mcg + 0.66 ml/ ml), inj. b1+b2+b6+b12+niacinamide + d-panthenol + choline chloride ( 20 mg+ 1 mg+ 20 mg+ 200 mcg+ 20mg+ 10 mg+ 3 mg)/ ml, inj. buparvaquone (50 mg/ ml), inj. buserelin acetate (0.0042 mg/ml), inj. calcium borogluconate (25% w/v), inj. cefoparazone + tazobactum (3 g + 375 mg), inj. cefoparazone sod. + sulbactum sod. (3 g+ 1.5 g), inj. cefotaxime sod. (500 mg), inj. ceftriaxone + tazobactum (3000 mg + 375 mg), inj. ceftriaxone (3gm), inj. dextrose + sodium chloride + potasium chloride + calcium chloride + sodium lactate (20%+0.6g+0.04g+0.027g+0.312g), inj. diminazine diaceturate + phenazone (70 mg + 375 mg), inj. dinoprost tromethamine (5 mg/ ml), inj. doramectin (10 mg/ ml), inj. enrofloxacin (10%), inj. flunixin meglumine (equ. to flunixin 50 mg), inj. fortified procaine penicillin (40 lac), inj. gentamycin (40 mg/ml), inj. hydroxyprogesterone caproate (250 mg/ml), inj. isoflupredone 2mg/ml, inj. ivermectin (1% w/v), inj. levamisole hcl (75 mg/ ml ), inj. oxytetracycline (125 mg/ml), inj. oxytetracycline (50 mg/ml), inj. prostaglandin f2 (7.5%),

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39816523

15 Apr, 2025 NA

Ambala - Haryana

Tender For supply of tab paracetamol 325mg plus diclofenec 50mg plus chlorzoxazone 500mg , tab mirtazepine 15mg , tamsulosin 0 point 4mg cap , vitamin e 200mg cap , tab feropenum sodium 200mg plus potassium clavulanate 125mg , tab aspirin 75mg plus atorvastatin 10mg , tab metformin 500mg plus glimepride 1mg , tab metformin 500mg plus glimepride 2mg , tab telmisartan 40mg plus chlorthalidone 12 point 5mg , tab ursodeoxycholic acid 600mg , syp bromhexine 4mg 5ml bott of 120 ml , ketaconazole 2 percent and salicyclic acid 2 percent lotion in 60 ml , syrup multivitamin consisting of copper manganese selenium zinc folic acid methylcobalamine vit a vit b1 vit b12 vit b3 vit b5 vit b6 vit c vit e , tab acebrophylline sr 200mg , tab gabapentin 400mg plus nortriptyline 10mg , tab pregabalin 75mg plus methylcobalamin 750mcg , tab rifaximin 550mg , tab eplerenone 25mg bid number/ & ( * ) : gem/2025/b/6084896 dated/ + : 25-03-2025 bid document/ 2 2 1 / 19

Loading, Please wait...

Thiobarbituric Acid Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector