Thiobarbituric Acid Tenders

Get complete information related to latest Thiobarbituric Acid Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Thiobarbituric Acid Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Thiobarbituric Acid Tenders .

Filter

Loading....

Get Tender in Email

Central Government/Public Sector

CTN :40025038

07 May, 2025 4.20 Lacs

Sambalpur - Odisha

Tender For supply of lab equipment - charts , models , slide permanent , specimens , pictures posters charts , beaker , dropping bottle , forceps , funnel , micro viewers , microscope , petri dish , pipette , skeleton , test tube holders , test tube stand , watch glass , water bath , wash bottle , burette , capillary tube , thermometer , ammonium solution , chromatography paper , formaldehyde , glycerine , robert solution , micro cover slip , micro glass slides , millions reagent , needle , nitric acid , sucrose , test tube ordinary , ph paper , blade for section cutting , acetic acid , brushes , blow pipe , burette stand , test tube brush , cork borer , cork presser , crucible tongs , charcoal slab borer , crucible , deflagrating spoon , distilation apparatus , drying cones , funnel stand or filter stand , pestle and mortar , pinch cock , retort stand , round file , sand bath , spirit lamp , test tube stand , test tube holder , triangular stand , tripod stand , trough , wire gauze , triangular clay pipes , beehie sheft , burettle , china dish , conical flasks , dessicator , gas jar dises , flasks , gas jar or cylinder , glazed tile , measuring flasks , retort , thistle funnel , woulfes apparatus , watch glass , ammonium carbonate , ammonium chloride , ammonium sulfate , ammonium bromide , aluminum sulfate , iron sticks , potassium nitrite , ammonium oxalate , sodium thiosulphate , zinc sulfate , cobalt nitrate , sodium hydroxide , copper sulfate , potassium nitrate , oxalic acid , magnesium sulfate , magnesium chloride , ammonium phosphate , sodium chloride , potassium ferrocyanide k4fe cn 6 , ferrous sulfate , sodium bromide , ammonium ferrous sulfate , potassium dichromate , barium chloride , strontium nitrate , sodium sulphide , potassium chromate , lead acetate , sodium sulfate , potassium iodide , lead nitrate , cedric ammonium nitrate , 2,4 dnp , universal indicator , ammonia solution nh4oh , phenol , aniline , bromine water , acetaldehyde , fehling solution a b , acetone , carbon disulfide , phenolphthalein , nesslers reagent , ammoniumm olybdate , nickel carbonate , nickel sulfate , manganese chloride , calcium chloride , sodium bisulphate. , cobalt acetate , chloroform , magnesium ribbon , zinc granual , lead nitrate pb no3 2 , potassium iodide ki , lead metal pb , ethyl acetate , sodium metal , pottasium permanganet kmno4 , pottasium dichromate k2cr2o7 , hydro chloric acid hcl , sulphuric acid h2so4 , nitric acid hno3 , ethanol , test tube , test tube holder , dropper glass , filter paper , glass rod , sodium sulfite , picric acid , borax , cobalt glass , aluminum metal , spatula , laboratory thermometer , drawing board , friction apparatus complete set with weight box , parallelogram apparatus , helical spring apparatus with weights , resonance apparatus , spherometer , screw gauge , wooden scale , stopwatch , sonometer set , sprit level , vernier calliper , beakers , connecting wires , concave mirror , convex mirror , convex lens , concave lens , glass slab , pendulum bob , cork rubber , hanger weights , metalic bob , slinky spring , spring balance , copper calorimeter , wave pendulum , barometer tube , lactometer , proof plane , boyles law apparatus , fortnis barometer , metallic cylinders brass , metal sphere , youngs modulus apparatus , hydrometer , tunning fork , rubber pad , copper sulphate bid details/ 2 / 142

CTN :39889570

15 Apr, 2025 30.00 Lacs

Multi City - Haryana

Tender For supply of lab reagents and consumables - semi-automactic bio-chemistry analyzer, albumin (5x50ml), alkline phosphtase 4x24 + 4x6ml), bilirubin kit (4x60ml), cholestrol kit (5x30ml), creatinine kit (4x60m)l, ggt (5x6.5ml), glucose kit (5x60ml), hdl kit (4x30ml + 4x10ml), high control for semi auto (1x5ml), normal control for semi auto (1x5ml), sgot kit (4x24ml + 4x6ml), sgpt kit (4x24ml + 4x6ml), total protein (5x50ml), triglycerides kit (4x24ml + 4x6ml), urea kit (4x24ml + 4x6ml), uric acid kit (4x24ml + 4x6ml), wash kit (4x50ml), general lab chemicals and consumables, absolute alcohol 70% (500 ml), almunium slide tray, anti ab, anti d ( igg+ igm), anti human sera/ coombs sera, anti sera abo rh/ blood group test kit (10ml each, total 30ml), anti-d igg 10 ml, anti-d igm 10 ml, aso 50 test titer rapid method, band aid, beaker 1000ml, beaker 100ml, beaker 250ml, beaker 500ml, blood grouping plate, blotting sheet, blue tips, bovine albumin, capillary tubes, card for haemo spot, centrifuge tube stand 15 ml(10*2), centrifuge tube stand 50 ml(15*2), conical flask 500 ml, coplin jars, copper sulphate powder 500gm, covid elisa anigen kit (icmr approved), crp 50 test kit (qualitative), cryo box with lid, cryo vials 2 ml, culture swab stick, diamond marking pencils, disposable alcohol swab, disposable esr pipette, disposable esr tube (westergen method), distilled dionized water 5 ltr, distilled double dionized water 5 ltr, distilled triple dionized water 5 ltr, double blood bag 300 ml, dpx mount, durham tube, edta vial (non vacuum), edta vial (vacuum), eppen drop vial ( mct ), esr black vial (non vacuum), esr black vial (vacuum), esr stand, ethanol absolute, falcon tube, filter paper, filter tip 10 micro litre (1*960), filter tip 100 micro litre (1*960), filter tip 20 micro litre (1*960), filter tip 200 micro litre (1*960), filter tip 5 micro litre (1*960), floride vial (non vacuum), floride vial (vacuum), fouchet reagent, giemsa stain 125 ml, glacial acetic acid, glass bottel round 1000ml, glass bottel round 500ml, glass cover slip 22 mm, glass pipett 10ml, glass pipett 2ml, glass pipett 5ml, glass slide, h & e stain (haematoxillin stain), h.i.v elisa 4th generation (96 test), hand sanitizer 5 ltr (ip base), hbsag card, hbsag elisa 4th generation (96 test), hcv elisa 4th generation (96 test), hcv rapid card, hiv rapid card, hydro chloric acid 500 ml, ice gel pack, j.s.b 1 stain, j.s.b 2 stain, kalazar test rapid card, lancet (auto destroyable/safety lancet), lancet (twisted round), leucoreduction filter, lieshmen powder 25 gm, lugal iodine 125 ml, malaria antigen card, manual rna extraction kit 50 test (icmr approved), mathenol 2.5 ltrs, mct vials 1.5ml, mct vials 2.0ml, measuring cylinder 1000ml, measuring cylinder 100ml, measuring cylinder 20ml, measuring cylinder 500ml, microscope cover glass 22 x 40 mm, micropipette single channel fixed volume fully autoclavable (all size variants), micropipette single channel variable volume fully autoclavable (all size variants), micropipette 8 channel variable volume fully autoclavable (all size variants), micropipette 12 channel variable volume fully autoclavable (all size variants), multistix, n/10 hcl 500ml, naoh sodium hydroxide, og 6, oil immersion 25ml, o-toluidine (500ml), parafilm tape, pastuer pipette, ph paper 5.0 to 7.5, plain vial (non vacuum), plain vial (vacuum), potassium permagnate, ppe kit (citra & drda approved), pregnancy cards/ upt cards, qiaamp dna blood mini kit (250 test), qiaamp viral rna blood mini kit (250 test), quadraple blood bags 450ml, ra factor 50 test kits, rapid antigen detection card test for bacterial meningitis, rapid pap stain kit, rapid test card for cephalosporin, rapid test kit igg, igm, ns1 for dengue, reversible rack mct, rt-pcr flu kit (192 test), rt-pcr hbv quantative kit (192 test), rt-pcr hcv quantative kit (192 test), rtpcr kits 96 test for covid-19 (icmr approved), rubber teat for pipette, salt iodine testing kit, sample cup with label (3 s

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39817354

23 Apr, 2025 87.71 Lacs

Belagavi - Karnataka

Tender For supply of lot-7 items to belagavi zone prisons - cpb-bottom wheel all size, cpb-drawer lock all size, cpb-sliding glass wheel all size , cpb-aluminium double channel all size , cpb-drawer handle all size, cpb-yellow amber, cpb-aluminium tower bolt all size, cpb-abro tape , cpb-plastic can wire, cpb-planning blade , cpb-mobile oil., cpb-emery/sand paper , cpb-sand paper , cpb-leminated sheet, cpb-laminated sheet , cpb-wood polish, cpb-adasive for corpentry, cpb-pencil, cpb-bee-wax, cpb-ost plywood, cpb-plywood sheet-6 mm, cpb-plywood sheet-19 mm, cpb-cr plywood, cpb-primmer wood or metal, cpb-hinges all size, cpb-wire nails all size, cpb-n.c. thinner, , cpb-terpent oil , cpb-painting brush , cpb-measuring tape , cpb-key plates ms all size, cpb-hinges , cpb-hacksaw blades different size, cpb-grinding wheel / stone , cpb-emery paper-water proof , cpb-drill bit different sizes , cpb-cutting machine spare parts, cpb-cutter blade (hand), cpb-cot bush , cpb-bush different size for cot and chairs, cpb-robin blue, cpb-tin opal, cpb-washing soda.., cpb-charcoal, cpb-male female socket , cpb-iron box socket , cpb-landry iron box coil , cpb-direct dyes colour, cpb-napthol colour, cpb-chloro phenyl, cpb-deel wood box, cpb-raw colour, cpb-hydrosulphate of soda, cpb-hydro chloric acid., cpb-washing soda., cpb-rosin , cpb-sodium silicate, cpb-phenyl colour, cpb-1 litre plastic bottle, cpb-carbolic acid, cpb-soap colour, cpb-stone salt, cpb-rosin paste, cpb-pine oil, cpb-perfume phenyl scent, cpb-perfume soap, cpb-neem oil, cpb-maha karanja oil, cpb-fire wood., cpb-creosote oil , cpb-caustic soda., cpb-coconut oil., cpb-castor oil, cpb-elastic , cpb-white thread tube, cpb-marking chalk, cpb-machine needles , cpb-pant hooks, cpb-machine oil, cpb-pocket cloth , cpb-over lock thread , cpb-khaki button, cpb-hand needles, cpb-pressing button, cpb-pant patti canvas, cpb-pressing canvas, cpb-khaki zips , cpb-khaki thread tube , cpb-cutting scissors steel 10inch 12inch, cpb-white button, cpb-thread tube (all shades) , cpb-measuring tape, cpb-colour thread (different shades) , cpb-bobbin case, cpb-bobbin tailiring, cpb-blouse hooks , cpb-fire wood, cpb-shuttle pegs, cpb-direct dyes, cpb-washing soda, cpb-vat colour, cpb-turkey red oil, cpb-tino pal, cpb-sodium nitrate, cpb-shuttle tongue (pin), cpb-salt., cpb-naphthol colour, cpb-mobile oil, cpb-loom spring , cpb-leather belt loom , cpb-caustic soda, cpb-hydro sulphate of soda, cpb-hydro chloric acid, cpb-h.s. woollen yarn, cpb-greece, cpb-different colours dyed yarn-20s, cpb-different colours dyed yarn-6s, cpb-different colours dyed yarn-10s, cpb-different colours dyed yarn-2/10s, cpb-different colours dyed yarn-2/20s, cpb-g.c. yarn-6s, cpb-g.c. yarn-20s, cpb-g.c. yarn-2/40s, cpb-g.c. yarn-2/20s, cpb-g.c. yarn-2/10s, cpb-g.c. yarn-10s, cpb-g.c. yarn-3/6s

Loading, Please wait...

Thiobarbituric Acid Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector