Latest sodium iodide Tenders | Government sodium iodide Tenders

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39697186

29 Mar, 2025 NA

Multi City - Telangana

Tender For corrigendum : supply of etp chemicals and consumables-, antiscalent chemical for ro membrance (water palnt), antiscaling chemical with ph booster for 5mt boiler dosing, ink cartridges, makeup cartridges, cleaning solution, etp chemicals, hydrochloric acid (hcl), sulphuric acid, lr grade, 05 ltrs pack, k2cr207potassium dichromate er 500 gr pack, ferroin indicator, 100 ml pack, mercuric sulphate,250 gr pack, silver sulphate, 25 gr, petroleum ether,2.5 ltrs , sodium azide 100 gr , manganous sulphate 500 gr , manganoussulphatemonohydratesq 500g, ferric chloride250 gr , calciumchloride250 gr , hcl250 ml , starch500 gr , ferrous sulphate500 gr , whatman filter paper 40 no - 01 no's, whatman filter paper, 41 no-01 no's, normal filter paper 1mx1m- 02 no's (10 sheets), sodium hydroxide pellets250 gr , sodium iodide100 gr , sodium thiosulphate500 gr , kh2p04 (potassium dihydrogen o phosphate) 250 gr, na2hp04sodium phosphate monobasic anhydrous er 250 gr, buffer solution ph 4.0 , buffer solution ph 7.0 550ml , buffer solution ph 9.2 550ml , ferric alum, pac, dap , hypochlorite , urea

CTN :39724261

01 Apr, 2025 NA

Jammu - Jammu And Kashmir

Tender For corrigendum : supply of management support , chemicals and glass ware equipments for rate contract on l1 basis - hpcl grade acetonitrile 2.5 ltr, hpcl grade water 1.00 ltr, disodium hyrogen citrate sesquihydrate 500 gm, primay secondary anemia (psa), silica gel 90 c 500 gm, anhydrous sodium acetate (ar) 500 gm, chlorpyripphos (crm), thiamethoxam (crm), imidacloprid (crm), cypermethrin (cmr), spiromesifen (crm), ptfe membrane filter for syringe 0.22 micron 1pck of 50 each, dichloromethane (hplc grade), n-hexane (hplc grade), ethyl acetate (hplc grade), syringe (10-25 microliters), flourisil, nitric acid ar grade, perchloric acid (ar grade), deionised water, standards of elements (nitric acid matrix) 1000 ppm, hydrogen peroxide, pipette - 1-5 ml, pipette - 200-1000 ml, pipette - 20-200 ml, hot plate, beaker 25 ml, beaker 250 ml, beaker 500 ml, beaker 100 ml, volumetric flask 25 ml, volumetric flask 250 ml, volumetric flask 500 ml, volumetric flask 1000 ml, conical flask 25 ml, conical flask 250 ml, conical flask 500 ml, conical flask 1000 ml, burette 25 ml, burette 50 ml, tatration stand, tongs, spatula, measuring cylinders 25 ml, measuring cylinders 250 ml, measuring cylinders 500ml, measuring cylinders 1000 ml, fehling solution a 500 ml, fehling solution b 500 ml, hydrochloric acid 500 ml, sucrose 500 gm, sodium carbonate 500 gm, methylene blue indicator 125 ml, iodine solution 250 ml, sodium hydroxide 500 gm, sulphuric acid 500 ml, sodium thio sulphate 500 gm, starch 500 gm, pot. terrocyanide 500 gm, zinc acetate, sodium bisultate 500 gm

Central Government/Public Sector

CTN :39446063

28 Mar, 2025 45.00 Lacs

Belgaum - Karnataka

Tender For corrigendum : supply of 1 hexane commercial grade per kg , 2 hexane commercial grade per kg , 3 hexane commercial grade per kg , 4 hexane commercial grade per kg , 5 hexane commercial grade per kg

Central Government And Public Sector

CTN :39478737

27 Mar, 2025 14.49 Lacs

Belgaum - Karnataka

Tender For corrigendum : supply of chemicals and consumables amr rkj - n-hexane 2.5 ltr , hexane-ar 2.5 ltr , ethyl acetate er 2.5ltr , dichloromethane 2.5 ltr , diethyl ether er 500 ml , methanol er 2.5 ltr , methanol hplc gradient grade 2.5 ltr , tetrahydrofuran hplc 1 ltr , silica gel 230-400 mesh 500 gm , silica gel 60-120 mesh 500 gm , sephadex g-10 50 gm , orientin , vitexin , isovitexin , homoorienti , isoorientin , apigenin , oleic acid , linoleic acid , methyl palmitate , palmitic acid , luteolin , myricetin , ergosterol , enlarging connecting adaptor , condensers , funnel 75 mm , funnel 100 mm , funnel 250 ml , condenser 3741016 , condenser 3741020 , rod for retort base burette stand , clamps , bossheads , spatula 6 inch , spatula 8 inch , glass mortar and pestle 150 x 110 , glass mortar and pestle 80 x 60 , boropure celulose nitrate membrane , boropure nylon 66 membrane hplc grade , pasteur pipette, ldp 3 ml , handypette pipette aid 10 ml , parafilm , chloroform-d , methanol-d4 , dimethyl sulfoxide-d6

CTN :39668047

03 Apr, 2025 NA

Bhopal - Madhya Pradesh

Tender For tender for purchasing of chemicals in controller food and drug - list of chemicals, acetonitrile, acetic acid, ammonium formate, methanol, formic acid, nitric acid, hydrogen peroxide, magnesium sulphate (anhydrous), hydrochloric acid, c18 cleaning salt, ascorbic acid, primary secondary amine, sodium accetate anhydrous, ammonium formate, ammonium hydrate, tetra butyl ammonium hydride, tetrabutyl ammonium sulphate, methyl chloride, dansyl chrodide solution, green s, ethanol, ammonium phosphate monobasic, acetic acid glacial, methylene chloride, ethyl ether, n-hexane, toluene, ethyl acetate, potassium phosphate monobasic, ortho phosphoric acid, ammonium acetate, sodium sulphate anhydrous, alchohol ethanol, acetic acid glacial, acetone (hplc), aluminium oxide (activated), amonium solution, potassium sulphate, potassium iodide, silver nitrate, alkali blue 6b, boric acid, sodium thiosulphate, eosin 2% (staining solution), calsium chloride, carbon tetrachloride, barium chloride(dihydrate), edta, erichrome black-t, furfural, orthophosphoric acid, glycerol, hydrochloric acid, isopropanol, iso-amyl alchohol, methanol(hplc), nitric acid, petroleum ether 40-60, petroleum ether 60-80, phenolphthalein, potassium permagnate, resourcenol, sucrose, sulphuric acid, tlc plate, hplc water, dyethyle ether, chloroform, amylacitate, fehling sol. a, fehling sol. b, iodine resublimed, sodium hydroxide pellets, cyclohexane, methanol, ammonium chloride, ammonium hydroxide, murxide, pattons and readers, calcium, trifluoro acetic acid, edta disodium salt(dihydrate), name of culture media/serum/ chemical, agar base, baird parker agar base, egg yolk tel emulsion(50ml/100ml per vial), bismuth sulphite agar, bhi broth, brilliiant green bile broth 2%, buffered peptone water, cooked meat medium (rc medium), carbohydrate consumption broth, decarboxylase test medium (falkow), dextrose tryptone agar, fraser broth base, fraser selective supplement, fraser supplement, emb agar, levine, hugh-leifson medium, kligler iron agar, koser citrate medium, lactobacillus mrs agar, lactose broth, lysine iron agar, macconkey agar, motility test medium, mr-vp medium, myp agar base (phenol red egg yolk polymyxin agar base), poly b selective supplement, egg yolk emulsion(50ml/100ml per vial), modified listeria oxford agar base, colcef selective supplement, nitrate broth, nutrient broth, peptone water diluent, plate count agar, listeria identification agar base (palcam), palcam selective supplement, selenite cysteine broth, sheep blood agar base, thiosulphate citrate bile salt sucrose agar(tcbs), triple sugar iron agar, tryptone broth (tryptone water), urea agar base, xylose lysine deoxycholate agar (xld agar), tryptic soy agar, violet red bile agar, perfringens agar base, tsc selective supplement, cmf selective supplement, tryptone glucose extract, thioglycolate agar, tryptone salt agar w/1% nacl, tetrathionate broth base (w/o iodine & bg), potato dextrose agar, phenol red broth base, my 40 (osmophillic agar), acetate agar, czapek yeast (autolysate) agar, 10% lactic acid solution (10 ml/vial), ec broth, gn broth, hajna, hektoen enteric agar, lauryl sulphate broth (lauryl tryptose broth), liver broth / l-broth, modified, malonate broth, malt agar, mannitol salt agar base, glucose agar, yeast extract powder, peptone, rappaport vassilidis medium, saline nutrient agar, alkaline saline peptone water, onpg broth, bolton broth base, bolton selective supplement, violet red bile glucose agar w/o lactose, iron sulphite agar, ellners broth, willis and hobb s medium, glucose of medium, tryptone bile glucuronic agar (tbx agar), tergitol-7-agar base, ttc solution 1% (10ml/vial), macconkey broth, macconkey broth purple, simmons citrate agar, macconkey sorbitol agar, tryptone soya yeast extract broth, hicrome listeria ottaviani agosti agar, oa selective supplement, lp enrichment supplement, mueller kauffman tetrathionate broth base, chromogenic coliform agar, slantz & burtley medium, bile

State Government

CTN :39651897

01 Apr, 2025 8.00 Lacs

Delhi - Delhi

Tender For supply of chemical - butan 2 one butanone ethyl methyl ketone 500ml , 1 bromobutane 500g , 4 bromobenzaldehyde 250g , acetic acid glacial 25ltr , acetone 25ltr , acetone uv hplc 500ml , acetonitrile 500ml , acetophenone 500ml , acetyl acetone 500ml , acetyl chloride 500ml , alpha naphthol 1 naphthol 100g , ammo ferrous sulphate ar , aluminium ammonium sulphate 500 g , aluminium chloride 500g , ammonia liquor 500ml , ammonium acetate 500g , ammonium chloride 500g , ammonium nitrate 500g , ammonium thiocyanate 500g , aspirin 250g , s benzyle thiuanium chloride 500g , benzaldehyde 500ml , benzamide 500g , benzil 250g , benzoic acid 500g , benzoyl chloride 500ml , benzyl tri phenyl phosphonium chloride 500g , bismuth nitrate 100g , boric acid 500g , bromine 20x5ml , bromobenzene 250ml , butyl alcohol 25ltr , carbon tetra chloride 500ml , cetyl alcohol 500g , chlorobenzene mono chlorobenzene 500ml , chloroform 500ml , cobalt chloride 100g , cobalt chloride hexahydrate 100g , copper acetate monohydrate 250g , copper sulphate cuso45h2o ar , cyclohexanone 500ml , d fructose 100g , di ammonium hydrogenphosphate , di butyl phthalate 500g , di sodium tetraborate borax 500g , dl tryptopan 10g , ethyl aceto acetate 500ml , glycerine glycerol , hexane 500ml , hydrochloric acid gr 500ml , hcl , iodine 100g , iron sulphide 1kg , lead carbonate 500g , magnesium stearate 500g , magnesium trisilicate 500g , maleic anydride 500g , manganese ii sulphate 500g , methanol 500ml , methyl acetate 500ml , mineral oil , n butanol 25ltr , n butyl acetate 500ml , nitric acid ar 500ml , nitric acid lr 35kg chaudhey chemicals , n methyl aniline 500ml , orthophosphoric acid 25ltr , oxalic acid ar 500g , parabens 500g , phenyl hydrazine hydrochloride 100g , phthalic acid 500g , pigment 500g , polyphosphoric acid 500g , potassium bromate 500g , potassium dichromate 500g ar , potassium iodide , potassium oxalate 500g , potassium phosphate tribasic 500g , potassium sodium tartrate 500g , rhodamine d 100g , semicarbozide hydrochloride 100g , sodium acetate anhydrate 500g , sodium acetate anhydrous 500g , sodium bicarbonate 500g ar , sodium hydroxide pelletes 500g , sodium oxalate 500g ar , sodium sulphite 500g , stearic acid coloring agent 500g , succinic acid 500g , sucrose 500g , sulphuric acid lr 4 5kg chaudhry chemicals , t butanol 500ml , t butyl cyclohexanone 500ml , tlc silica gel aluminium plates , toluene 2 5ltr , tri sodium citrate 500g , tryptophan 25g , urea 500g , beaker 100ml , beakers 250 ml , beakers 400 ml , bodmel flask melting point appertus , boiling tube , brush semi miceo kit , brush bottle 18 , burette clamp boss head , burette clamp fish type , capiller tube pkt , conical flask 150 ml , conical flask 250 ml , dropper 6 glass , dropper 3ml plastic 500pcs , dropper 1ml plastic 500pcs , filter paper whatman no curculer , filter paper crometography , filter paper ordnery extra obgerb500 sheet rim , funnel 2 , labolin 5ltr , measuring cylender 10 ml borosil glass , measuring cylender 25 ml borisil glass , rubber tube 5mm , rubber tube 6mm , rubber tube 7mm , rubber tube 8mm , rubber tube 9 mm , spatula steel 6 , test tubes 15 125 mm 100pcs , viscometer borosil glass , volumetric flask 100 ml , water bath alluminium , wire gauze bid details/ 2 / 103

Central Government / Public Sector

CTN :39652058

01 Apr, 2025 NA

Faridabad - Haryana

Tender For supply of dextrose , glycerol mol bio , nutrient broth , l cysteine , aluminium nitrate nonahydrate , ferric nitrate a.r grade , peptone , n-pentane ar cas no. 109 66 0 , tetra hydro furan 99.9 percent hplc , aceto nitrilehplc , sodium hydroxide pellet ar , sodium molybdate ar , n hexane lr , dipotassium hydrogen phosphate , sodium acetate anhydrous , n hexane ar , ethanol ar , tetra propyl ammonium bromide lr grade , acetone lr , nitric acid lr , n heptane , hexane commercial , hexane lr , n heptane ar gr , n heptane lr , 2 ethyl hexanol , ethyl acetate lr , sodium hydrogen carbonate lr ar , sodium carbonate ar , cyclo hexane ar , potassium dihydrogen phosphate lr , potassium dichromate lr , acetone ar , petroleum spirit 60 80 lr , magnesium sulphate heptahydrate , carbon di sulphide ar gr , methanol lr , methanol ar , chloroform lr , iso propyl alcohol ar , ammonium sulphate ar grade , dichloromethane hplc , dimethylformamide 99 plus percent , ethyl acetate min 99 percent purity

Central Government/Public Sector

CTN :39622985

28 Mar, 2025 NA

Bangalore - Karnataka

Tender For purchase of chemicals and consumables - agar pt pure , agar agar type i , sodium alginate , antimicrobial supplement , cephotaxime sodium salt , calcium nitrate , d-glucose anhydrous , hygromycin-b , lcystein , metatopolin , phytawrap , sucrose , syringe driven filters , phyta jar , streptomycin sulphate , supplement for ms media , dichloromethane , diethylether , toluene , cyclohexane , p-anisaldehyde , acetone , qualitative filter paper , formaldehyde , acetone pure , n hexane pure 99 percent , n pentane extra pure 99 percent , tlc aluminium sheets silica gel 60f 254 , storage vial 10 ml , funnel plastic , ethanol , toluene ar grade , octanoic acid or caprylic acid , ethanolamine , agar agar type i , malt extract powder , methanol , toluene lr grade approx. 98 to 99 percentage purity , ethyl acetate, hi-ar , weasons salt mixture , yeast tablet , methyl para hydroxy benzoate , sorbic acid , cellulose , ascorbic acid , choline chloride , potassium hydroxide pellets , agar agar type 1 , sodium hypochlorite ar acs 4 percentage wight by volume solution , potato dextrose agar, granulated , nutrient agar , nutrient broth , potato dextrose broth, granulated , sabouraud chloramphenicol agar , gibberellic acid , formaldehyde solution 37 to 41 percent, hi lr , potassium permanganate hi ar , chloramphenicol,for molecular biology , gram stains - kit , beaker , conical flask , glass spreader , inoculation loop , forceps , cork borer , spatula , jerri can , micro slides , microscopic cover slips , measuring cylinder transparent , immersion oil , apparatus , insect breeding dishes , dna extraction kit , dna purification kit

State Government

CTN :39605894

28 Mar, 2025 NA

Delhi - Delhi

Tender For supply of laboratory chemicals - acetocarmine , acetone , acrylamide , agarose , alpha naphthylamene , ammonium persulphate(aps) , bovine serum albumin (bsa) , butanol , cadmium chloride , chloroform , cholesterol (liquid state) kit from recombigen , dna ladder , ethylenediaminetetraacetic acid (edta) , ferric chloride , formaldehyde , glycine , hexane , hiper yeast cell immobilization kit , hydrogen peroxide , indian ink , l-arginine(amino acid) , lead chloride , leucine(amino acid) , lysine , mcconkey agar , mercuric chloride , phenylalanine , proline , protein ladder , sodium lauryl sulphate or sds , taq polymerase , tributyrin agar , tris base , tryptophan(amino acid) , temed , xylene

Sodium Iodide Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

Central Government And Public Sector

State Government

Central Government / Public Sector

Central Government/Public Sector

State Government