Web Analytics Made Easy - StatCounter

Sodium Iodide Tenders

Get complete information related to latest Sodium Iodide Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Sodium Iodide Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Sodium Iodide Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

Central Government/Public Sector

CTN :39835162 Due date: 16 Apr, 202516 Apr, 2025 NA
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39697186 Due date: 29 Mar, 202529 Mar, 2025 NA
Tender For corrigendum : supply of etp chemicals and consumables-, antiscalent chemical for ro membrance (water palnt), antiscaling chemical with ph booster for 5mt boiler dosing, ink cartridges, makeup cartridges, cleaning solution, etp chemicals, hydrochloric acid (hcl), sulphuric acid, lr grade, 05 ltrs pack, k2cr207potassium dichromate er 500 gr pack, ferroin indicator, 100 ml pack, mercuric sulphate,250 gr pack, silver sulphate, 25 gr, petroleum ether,2.5 ltrs , sodium azide 100 gr , manganous sulphate 500 gr , manganoussulphatemonohydratesq 500g, ferric chloride250 gr , calciumchloride250 gr , hcl250 ml , starch500 gr , ferrous sulphate500 gr , whatman filter paper 40 no - 01 no's, whatman filter paper, 41 no-01 no's, normal filter paper 1mx1m- 02 no's (10 sheets), sodium hydroxide pellets250 gr , sodium iodide100 gr , sodium thiosulphate500 gr , kh2p04 (potassium dihydrogen o phosphate) 250 gr, na2hp04sodium phosphate monobasic anhydrous er 250 gr, buffer solution ph 4.0 , buffer solution ph 7.0 550ml , buffer solution ph 9.2 550ml , ferric alum, pac, dap , hypochlorite , urea

Central Government/Public Sector

CTN :39751790 Due date: 09 Apr, 202509 Apr, 2025 NA
Tender For supply of diamond lapping compound (rough) of greaves cotton /bhukhanvala diamond tools (hi-fin brand) grade 8 , diamond lapping compound (fine) of greaves cotton/ bhukhanvala diamond tools (hi-fin brand) grade 8- , carbolap boron carbide paste mesh-80 grade 150 in 200 gm net packing.
 Loading, Please wait...

Connect us via What's Up