Latest sodium iodide Tenders | Government sodium iodide Tenders

State Government

CTN :39826251

10 Apr, 2025 50.00 Lacs

Kotdwar - Uttarakhand

Tender For lab reagents supply work at govt base hospital kotdwara - items articals for lab, binocular microscope with lens, electrolyte (na+,k+,ca+) pack, esr disposable westergren tube, esr stand wintrobe, esr stand westergren, spirit lamp, test tube rack (aluminium), slide box, hot air oven, incubator, stethoscope, blood pressure machine, physical balance &weight box, rh viewing box(electrical), photocaloriemeter, oil immersion lens 100x, stopwatch, timer, vdrl shaker with timer, semi auto analyser, antisera abd, acetone, acetic acid glacial, ammonia solution, ammonium sulphate powder, ammonium oxalate powder, auto pipette 5-50ul, benedicts solutionqualitative, benedicts solution quantitative, brush test tube, barium chloride 10%, conc . hcl, conc. h2so4, conc hno3, carbol fuchsin, test tube rack aluminium, high power lens 40x, low power lens, auto pipette 50-200ul, auto pipette 1000ul`, auto pipette 500ul, auto pipette 10ul, dropping bottle plastic 1000ml, neubaver counting chamber, disodium hydrogen phosphate, dropping bottle plastic125 ml, distilled water, eosin powder, edta powder, ethenol, eherlichs reagent, aec diluting fluid, edta vial, esr filling needle, fouchets reagent, filter paper, beaker plastic 100-1000ml, beaker glass 100-1000ml, centriguge tubes, glass test tube 12*75, glass test tube 12*100, glass cover slip, glass slide, glass capillary tube, glass haemoglobinometer, hb measuring tube 2-20%, glass pipette for hb 20ul, glass rbc pipette, glass wbc pipette, glass funnel, glass marking funnel, grams iodine, hydrogen peroxide, washing solution, pm kit (semi auto), am kit ( semi auto), glass cover slip, vacutainer vial red top, vacutainer vial, vaccutainer needles, aliquet 2ml, fluoride vials, sodium citrate vials, glass wbc pipette, glass funnel, dengue ns1ag/igm/igg card test, leishman stain, liquid paraffin, litmus paper red, litmus paper blue, methylene blue, multisticks for urine exam, malaria antigen card test, mountex ppd vial, n/10 hcl, pregnancy card test, typhoid dotigm/igg, vdrl card test, hbsag card test, hcv tridot, hiv tridot, urinometer glass, wintrobe esr tube, westergren esr tube, platelet diluting fluid, potassium oxalate, potassium dichromate, plastic washing bottle 250 ml, plastic stand, plastic funnel, pasteur pipette, potassium permagnate, printer roll/ paper, plane vial, edta vial, rubber bulb, rbc fluid, wbc fluid, sodium sulphate powder, sulphur powder, tips auto pipette white, tips auto pipette yellow, tips auto pipette yellow, semen diluting fluid, sodium hypochloride solution, tourniquette strong, tissue paper, uristicks for albumin sugar, urine collection pot disposable, wintrobe tube filler, xylene, liquor ammonia, acetone, aso latex slide test, raf latex slide test, crp latex slide test, rapid pap stain, diamond glass marker, gram stain, fnac plunger, ethanol, coverslip for fnac, mgg stain, gills haematoxylin stain, og / ea stain, 1% glacial acetic acid, wbc count fluid/ turk fluid, giemsa stain, spirit lamp, occult blood card test, water bath, thermameter

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39697186

29 Mar, 2025 NA

Multi City - Telangana

Tender For corrigendum : supply of etp chemicals and consumables-, antiscalent chemical for ro membrance (water palnt), antiscaling chemical with ph booster for 5mt boiler dosing, ink cartridges, makeup cartridges, cleaning solution, etp chemicals, hydrochloric acid (hcl), sulphuric acid, lr grade, 05 ltrs pack, k2cr207potassium dichromate er 500 gr pack, ferroin indicator, 100 ml pack, mercuric sulphate,250 gr pack, silver sulphate, 25 gr, petroleum ether,2.5 ltrs , sodium azide 100 gr , manganous sulphate 500 gr , manganoussulphatemonohydratesq 500g, ferric chloride250 gr , calciumchloride250 gr , hcl250 ml , starch500 gr , ferrous sulphate500 gr , whatman filter paper 40 no - 01 no's, whatman filter paper, 41 no-01 no's, normal filter paper 1mx1m- 02 no's (10 sheets), sodium hydroxide pellets250 gr , sodium iodide100 gr , sodium thiosulphate500 gr , kh2p04 (potassium dihydrogen o phosphate) 250 gr, na2hp04sodium phosphate monobasic anhydrous er 250 gr, buffer solution ph 4.0 , buffer solution ph 7.0 550ml , buffer solution ph 9.2 550ml , ferric alum, pac, dap , hypochlorite , urea

CTN :39774893

11 Apr, 2025 5.65 Lacs

Darjeeling - West Bengal

Tender For supply of drugs and pharmaceuticals - d ifa re 05 moxifloxacin 0 dot 05 cream tube of 5gm , d ifa re 05 desonide 0 dot 05 w w gel 10gm , d ifa re 05 nepafenac 0 dot 1 eye drop w v with carbomer 970 p eye drop with tainer system 5ml , d ifa re 05 glucose test strip accu check instant s , d ifa re 05 nebivolol 10mg tab , d ifa re 05 mometasone 0 dot 1 w w lotion 30ml , d ifa re 05 iron syp for adult with vitamins each 5 ml contains ferrous fumarrate 100 mg folic acid ip 3mg and vit b12 10 mcg , d ifa re 05 sodium chloride 3 solution for injection bott of 100 ml , d ifa re 05 dextrose 10 in 500ml inj , d ifa re 05 sterile corrugated drains , d ifa re 05 feeding tube 6fr , d ifa re 05 dispo sterile drapes for surgical trolley , d ifa re 05 hydrogen peroxide 3 6 , d ifa re 05 cling drape , d ifa re 05 cath mount , d ifa re 05 fuji dry view laser films 10 8 , d ifa re 05 disposable irrigation aspiration set , d ifa re 05 dispo mersilk no 1 cutting needle 45 mm 1 2 circle needle , d ifa re 05 dispo venous extension line lactospiral 200 cm , d ifa re 05 salicylic acid 2 face wash 60ml , d ifa re 05 infusar bag for epidural analgesic 300ml , d ifa re 05 fosphenytion sodium 150mg 2ml inj , d ifa re 05 dispo prolene polypropylene no 1 40 mm round body needle 75 cm , d ifa re 05 mallinckrodt micro laryngeal oral nasal tracheal tube cuffed size 5 dot 5 mm , d ifa re 05 mallinckrodt micro laryngeal oral nasal tracheal tube cuffed size 6 dot 5mm , d ifa re 05 water seal drainage , d ifa re 05 bimatoprost 0 dot 03 timalol 0 dot 5 eye drop 3ml , d ifa re 05 naloxone 0 dot 4 mg ml inj , d ifa re 05 clobetasolpropinate 0 dot 05 salicylic acid 6 urea10 lactic acid 5 oint 30gm , d ifa re 05 mometazone nasal spray 100 metered dosages 10 ml , d ifa re 05 benzoyl peroxide 4 wash 50 gm , d ifa re 05 chlorhexidine 4 with moisturizer bott of 500 ml , d ifa re 05 surgical hand antiseptic handrub with 1 chlorhexidine in alcohol based solution with moisturizer usfda approved 500 ml , d ifa re 05 fuji dry view laser films 12 10 , d ifa re 05 dolutegravir 50mg lamivudine 300mg tenofovir 300mg , d ifa re 05 shea butter mango butter cocoa butter dimethicone propylene glycol glycerine 75 gm , d ifa re 05 isotonic sodium chloride 0 dot 09 nasal spray 100ml , d ifa re 05 mallinckrodt micro laryngeal oral nasal tracheal tube cuffed size 6 dot 0mm , d ifa re 05 beclomethasone dipropionate 50 mcg and levosalbutamol 100 mcg per metred dose 200 ui inhaler , d ifa re 05 mephentermine 30mg ml inj vial of 10ml , d ifa re 05 folleys catheter double lumen latex 10 fr , d ifa re 05 azelastin 0 dot 1 nasal spray bott of 10 ml , d ifa re 05 sterile disposable monopolar electro cautery pencil pen with lead non stick silicon coated tip and colour coded switches for coagulation and cutting , d ifa re 05 solution minoxidil 5 alcohol free 60ml , d ifa re 05 disposable tourniquet velcro type , d ifa re 05 clobetasol propinate 0 dot 05 lactic acid 12 cream 30gm tube , d ifa re 05 colloidal iron folic acid and vit b12 syp 200ml , d ifa re 05 zinc oxide 25 cream 50gm , d ifa re 05 aloevera calamine pramoxine lot 100ml , d ifa re 05 calamine 8 aloe vera 10 light liquid paraffin10 olivem 800 lot 60ml

corporations/Associations/Others

CTN :39816385

15 Apr, 2025 NA

Delhi - Delhi

Tender For supply of dental surgical consumables and chemicals - disposable needles 18 gauge 1 point 5 length , disposable needles 23 by 24 gauge 1 length , disposable needles 26 gauge 1 point 5 length , cotton bandage roll , bandage than absorbant gauge cloth , 5 percent w by v povidone iodine solution , 2 point 45 percent glutaraldehyde solution , absorbant cotton roll , disposable sterile sample culture bottle , desnet aldehyde and phenol free non corosive environment 1 lit , disposable non woven bedsheet blue , sterile disposable syringe with needle 10 ml syringe with 21 gauge , sterile disposable syringe with needle 2 ml syringe with 24 gauge 1 needle , sterile disposable syringe with needle 5 ml syringe with 24 gauge 1 needle , elastic zinc oxide self adhesive bandage , edta non vaccum blood collection tube 4ml , latex medical examination gloves powdered iso certified medium bar small , absorbent cotton gauze than , glucostrip-accu sure soul one box of 100 strips , glucostrip-codefree one box of 50 strips , non-woven disposable bouffant head cap with elastic band blue colour , non-woven disposable hiv pack for personal protection for hospital use sterile , hydrogen peroxide , inj diclofenac sodium ip , insulin syringe with fixed 30g bar 31g needle , local anaesthesia 2percentage lignocaine hydrochloride with adrenaline , microporous surgical adhesive tape , nitrile gloves for examination size medium powder free blue3 colour , normal saline sodium chloride inj ip , plain vacutainer non vaccum blood collection tube 4ml red colour , alcohol based hand sanitizer , chlorhexidin gluconate ip , disposable shoe cover non woven fabric blue colour elastic band for fit , silk suture 3 hypen 0 three bar 8 circle 16 mm 12pcs , silk suture 3 hypen 0 ns 5028 seam silk three bar 8 circle 26 mm 12 pcs , silk suture 4 hypern 0 one by two circle 16mm , silk suture 4 hypen 0 3 by 8 circle 16mm , silk suture 5 hypen 0 3by8 circle 16mm , 3 percent sodium hypochlorite for dental use , sodium hypochlorite 5 percent by 10percent , soframycin ointment 30g , 3ply surgical face mask , sterile surgical latex gloves 6.5 , sterile surgical latex gloves 7 , disposable non woven surgical gown , surgical spirit for hospital use , detachble bard parker surgical blade no 11 stailess steel , detachble bard parker surgical blade no 15 , toilet paper roll plai white 2ply , vaseline white softparaffin , polyglactin absorbable suture 3 point 0 90cm length , polyglactin absorbable suture 3 point 0 70 to 90 cm length , polygactin absorbable suture 4 poit 0 , lignocaine hydrochloride jelly , copper sulphate , coverslips 22mm 50mm point zero eight to point one three mm thickness , creatinine kit , crystal violete 125 ml , dextrose glucose , disposable high profile blade for microtome , disposable plastic tissue embedding ring , dpx mountant , ethanol , filter paper whatmen , formalin 5lt , fructose , glass slide 50psc , glass slides , god by pod sugar kit , gram iodine , hydrochloric acid , hydrochloric acid nby10 hcl , immersion oil , inoculating loop with holder , isopropyl alcohol , leishman stain , liquid ammonia , litmus paper blue , litmus paper red , maltose , may grunwald giemsa stain , methylene blue , molisch reagent , paraffin wax , protein estimation kit , saffranine , sodium carbonate , sodium nitroprusside , specimen jar with lid , sucrose , sulphur powder , sulphuric acid , test tubes 15 125mm , test tubes 15 150mm , uric acid kit , xylene , yellow tips

CTN :39498732

27 Mar, 2025 NA

Ganganagar - Rajasthan

Tender For bid to ras bid to ras tender for supply of calamine 8 percent with 10 percent light liquid paraffin 50 ml bott , cannula iv fixator , capsaicin gel tube of 20 gm , carbidopa 25 mg plus levodopa 100 mg cr tab , carbimazole 20 mg tab , carbimazole 5 mg tab , carvedilol 12 point 5 mg , cefixime 200 mg 200 mg plus clavulanate 125 mg tab , cefoperazone sodium 1gm and sulbactum sodium 1gm inj , cefpodoxime 200 mg plus cefpodoxime 200 mg plus clavulanate 125 mg tab , cervical collar size s , cervical collar size xl , cervical traction kit , chlordiazepoxide 5 mg plus clidinium 2 point 5 mg plus dicyclomine hcl 10 mg tab , choline salicylate 8 point 7 percent plus lidocaine 2 percent bottle of 15 ml , cilnidipine 10 mg plus metoprolol 50 mg tab , cilnidipine 10 mg plus telmisartan 40 mg tab , cilnidipine 10 mg tab , cilnidipine 20 mg tab , clindamycin 1 percent plus adapalene 0 point 1 percent plus aloe alllantoin gel tube of 15 gm , clonazepam 1 mg tab , clotrimazole 1 percent w by v ip plus lignocaine 2 percent ear drop bott of 10 ml , coal tar 4 point 25 percent plus salicyclic acid 2 percent lotion bott of 60 ml , commfort back support , corn cap containing minimum salicylic acid 30 percent , cotton 300 gm , cotton non absorbent 500 gm , cyclosporine 50 mg cap or tab , cyclosporine a micro emulsion 25 mg cap , tab daflon 500 mg micronised purified flavonoid fraction of rutaceae 500 mg tab composed of diosmin 450 mg 90 percent flavonoid expressed as hesperidine 50 mg 10 percent , dental gel , denture adhesive powder , denture adhesive tube , dapagliflozin10 mg plus metformin 500 mg tab , diclofenac 50 mg plus paracetamol 500 mg tab , dicyclomine 10 mg plus mefenamic acid 250 mg tab , distillled water can of 5 ltr , dns fluid glucose saline isotonic solution self collapsible container dextrose 5 percent with 0 point 9 percent sod chloride 500 ml , donepezil 5mg plus memantine 10 mg tab , drotaverine 80 mg plus acceclofenac 100 mg tab , drotaverine hcl 80 mg plus mefenamic acid 250 mg tab , efavirenz 600 mg tab , enteral feed powder high protein 85 percent for renal patients sachet of 126 gm , esomeprazole 40 mg tab , estriol 1 mg vaginal cream tube of 15 gm , evening primrose 500 mg cap or tab , fenofibrate 200 mg plus atorvastatin 10 mg tab , fexofenadine 120 mg plus montelukast 10 mg tab , fexofenadine 120 mg tab , finasteride 5 mg plus tamsulosin 0 point 4 mg cap , finasteride 5 mg tab , fluocinolone 0 point 1 percent w by v shampoo bottle of 125 ml , frusemide 20 mg plus spironolactone 50 mg tab , fusidic acid 2 percent plus clotrimazole 1 percent plus clobetasol 0 point 05 percent w by w oint tube of 10 gm , fusidic acid oint or cream 2 percent tube of 10 gm , gabapentin 300 mg plus methylcobalamin 1500 mcg tab , glimepiride 2 mg plus metformin sr 500 mg plus voglibose , gloves operation size 7 point 5 non powdered pair of , gloves size 7 non powdered pair of , gluco strip one touch ultra bottle of 50 strips , glucometer one touch select plus machine , glucosamine 500 mg plus diacerin 50 mg tab , glucosamine sulphate 750 mg plus methysuphonyl methanone 200 mg plus anti oxidants and minerals , glucose powder packet of 200 gm , glutathione 250 mg tab , guaiphenesin ip 100mg plus dextramorphan 10 mg plus phenylepherine 5mg plus chlorpheniramine 4 mg each 5 ml sugar free syrup bott of 100 ml , halobetasol 0 point 05 percent plus salicylic acid 3 percent w by w cream tube of 15 gm , hbsag kit , human insulin analogue aspart premix 30 per insulin 70 per insulin protamine aspart suspension 100 iu per ml monocomponent insulin recombinant dna origin 3ml pfp or pfs , hydrogen peroxide solution with stabilizer ip 20 volume bott of 500 ml , ibuprofen 400 mg tab , iguratimod 25 mg tab , imatinib mesylate 400 mg cap , inh beclomethasone 200 mcg 200 metered dose inh , inh budesonide 200 mcg , inj cefotaxime sodium 1 gm , inj glucose solution 5 percent in non toxic disposable plastic bott of 500 ml ffs or equivalent technology , inj lignocaine

CTN :39676456

26 Mar, 2025 64.09 Lacs

Bangalore - Karnataka

Tender For dds rc 1 (call-2) - uro bag , uro bag -., ultrasound jelly can of 5 ltrs -., scalp vein sets 24g -., phenyl medical grade -., full sleeve body gown disposable -., ecg paper roll 210/215mm x 20m (compatible with akas machine) -., ecg jelly 250gm / bottle -., e.c.g.electrodes -., chlorhexidine 2% with 70% alcohol 500ml for skin antisepsis -., broad spectrum disinfectant -., bleaching powder -., autoclavable silicon coated rubber sheet 90cms x 10 mtrs roll -., antiseptic liquid soap for handwash can of 5 ltrs -., sodium hypochlorite soln.(bleach) 6-7% can of 20 ltrs. -., hydrogen peroxide -., formaline 37-40% (20 ltrs-can) -., pvc endotracheal tube no. 5.5 - plain -., o2 mask-pedeatric pedeatric disposable -., o2 mask-adult adult disposable -., cvp double lumen cather 7fr -., cvp catheter triple lumen 7fr -., vessel loop -., urine collection bag with urometer -., silicon foleys catheter (rusch)16fr 16 fr -., silicon foleys catheter (rusch)14fr 14 fr -., foleys catheter 18 fr two way -., foleys catheter 16 fr -., foleys catheter 14 fr -., foleys catheter 12 fr -., disposable hiv pack -., tetrastarch (6% hes) 130/0.4 -., n s 1000ml (sodium chloride) i.p. 0.9% -., dextrose i.p. 5% -., aztreonam inj. 10mg/ml -., nebuliser mask kit .-, e.c.g.electrodes .-, ecg jelly 250gm / bottle .-, chlorhexidine 2% with 70% alcohol .-, o2 mask-adult adult disposable .-, sodium hypochlorite solution (bleach) .-, hydrogen peroxide .-, formaline 37-40% (20 ltrs-can) .-, dobutamine inj. 50mg/ml .-, phenyl medical grade, digital thermometers single pieces, broad spectrum disinfectant, autoclavable silicon coated rubber sheet 90cms x 10 mtrs roll, antiseptic liquid soap for handwash can of 5 ltrs, sodium hypochlorite soln.(bleach) 6-7% can of 20 ltrs., hydrogen peroxide 20% vol (5litre can), vessel loop blue color, vessel loop red color, silicon foleys catheter (rusch)16fr 16 fr, silicon foleys catheter (rusch)14fr 14 fr, r o sponge 30cm x 30cm 8ply, foleys catheter 18 fr, foleys catheter 16 fr, foleys catheter 14 fr, foleys catheter 12 fr, disposable hiv pack specification attached (annexure-1), sofosbuvir and velpatasvir tab., polymixin b 500000 inj., polymixin b 750000 inj., ringers lactate pouch 1000ml 1000ml, electrolyte-p i.v i.p. inj. 500ml, aztreonam inj. 10mg/ml

Central Government And Public Sector

CTN :39711374

15 Apr, 2025 4.97 Crore

Belgaum - Karnataka

Tender For tender for rate contract supply of drugs items to bims belagavi - zince oxide 20gm cream, zinc syrup 60 ml , xylometazoline 0.1% nasal drops 10ml, white petrolium 100% pure jelly 500gm, white petrolium 100% pure jelly 30gm, wax solvent ear-drops 10ml benzocaine 2.7%w/v+chlorbutol5%w/v+paradichlorobenzene2%w/v+turpentine oil-15%w/v, vitamin-e drops 50mg/1ml-15 ml, vitamin-d3 60000 iusachet, vitamin d3 400-iu 15ml (drops), vitamin b complex 200ml (syrup), vitamin a syrup (60 ml), vitamin a solution (100ml), ultra sound gel (5kg), turpentine oil (100ml), tropicamide- 5ml eye drops , triple combination cream (momethasone 0.25% with tretin 0.1% with hydroquinone 2.0%) 15 gm, triamcinolone 0.1% w/v 5gm oral ointment, tretinoin 0.025% cream , topical5% emla cream 15gm, topical lignocaine 25mg/g, prilocaine 25mg/g cream-5%- 5 gm (cream), tobramycine 0.3%10ml (eye drops), tincture benzoine (100ml), timolol maleate 10ml eye drops, thrombophobe ointment (20gm), theophylline with etophylline (200ml syrup), sucralphate (170ml syrup), soft roll (15cm x3mtr), soft roll (10cm x3mtr), sodium valproate 200mg/100ml (syrup), sodium phosphate enema (100 ml), sodium hypochloride 5-6% solution 5ltr, sodium hypochloride 5-6% solution 20litr, sodium chloride (nasal drops), sodium by carbonet ip 600gms with sodium-chloride ip 230gms t packets 1x830, silymarin l-ornithine l-asparatate (200 ml syp), silver sulphadiazine -15gm cream, silver sulphadiazine -100gm cream, sildenafil oral suspension 10 mg/ml, salbutamol-nebulisation repsules 2.5mg 2.5ml (amp), salbutamol- nebuliser solution (salbutamol 100microgram/actuation pressurised inhalation 200 actuations(pi,cmi)-15ml., salbutamol 2mg (100ml syrup), prednisolone acetate 1% + hpmc 0.25%-5 ml eye drop , povidone iodine solution in dark plastic bottle 500ml 5% w/v (500ml), povidone iodine ointment 5%w/v (15gm), povidone iodine ointment 5%w/v (125gm), povidone iodine cleansingsolution in dark plastic bottle 7.5 %w/v (500ml), potassium chloride (200ml syrup), pop roll 2.7 mtr x 15 cm (1roll), pop roll 2.7 mtr x 10 cm (1roll), phenytoin sodium 125mg (100ml syp), phenobarbiton 20 mg/5 ml-(100ml syp), permethrin 5% 30gm ointment, paracetamol 125mg/100ml (syrup), ors (who formula) 21gm, orodispersible probiotic sachets 2 gm-10 (sachets.), ondansetron 4mg/5ml 30ml (syrup), nuprep gel (114 gm), normal saline nasal 10ml drops, neomycin sulphate, polymyxin b sulfate and hydrocortisone 5 ml ear drop-, natamycin 5ml eye drops, mupirocin 2% 5gm ointment, multi vitamin with zinc 200ml (syrup), multi vitamin (zinc+b12+b-comp) drop-30ml, moxifloxacin 0.5%5ml eye drops, moxifloxacin 0.5% 5gm eye ointment , mometasone 1% 15gm (cream), micropore plaster size1.25cm x 9.1mtr 0.5 inch1roll (tissue plaster), micropore plaster size 7.5 cm x 9.1mtr 3inch 1roll(tissue plaster), micropore plaster size 2.5 cm x 9.1 mtr 1inch 1roll (tissue plaster), metronidazole 1.5% w/w -20gm gel, mefenamic acid with paracetamol 50+125mg/5ml 60ml (syp), mct oil 100ml (medium chain triglyceride (mct oil (100ml), luliconazole cream 1%w/v (10gm), liquid paraffin (60ml), lignocaine gel 2% (30gm), lignocaine 10% 50ml (spray), levetiracetam 100mg/ml (syrup), lactulose (200ml syrup), ketokonozol 2%with zinc payrithione 1% (100ml), ketoconazole 2% 20gm (cream), iron and folic acid-30 ml (drops), iron and folic acid (200ml syrup), ipratropium(500.0 mcg) + levosalbutamol / levalbuterol(1.25 mg) 3 ml (respules), hydrogen peroxide solution (100ml) amber bottle wrapped with black thick polybag with printed label 6% w/v, hmf sachet 2gm ( (lactodex hmf nutritional supplement sachet, 2 gm/sachet) sachet, haemocoagulase drops (10ml), glycin irrigation- (3ltr), glycerin-(100ml), glycerin & sodium chloride enema (20ml), glucose-sachets 75gm (dipsi-test), frusemide 10mg (30ml syp), framycetin sulphate 1% 10gm (skin cream), formoterol 6mcg with tiotropium 9mcg mdi 200 metered dose (inhalar), formaldehyde (5ltr), fluticasone propionate 50mcg (nasal spary) 120 meter d

CTN :39478544

03 Apr, 2025 NA

Srinagar - Jammu And Kashmir

Tender For corrigendum : supply of medicine and medical items 200 - abo grouping kit , accu check active , aciloc 150mg , adhesive plaster 10cm x 5cm , albendazole 400 , albendazole syp , albumin 100 test , alp 100 test , amlodipine 5mg , amoxycillin 500 , amoxycillin 500 potassium clav 125 , antiacid gel , anticold , aristogyl 400 , astawin ls , automatic biochenmistry analyzer , avil inj , azithromycin 250 , azithromycin 500 , b p blade no 10 , b.complex with mecobalmin , b.p. blade no. 14 , bandage 3 inch , bandage 6 inch , basilog inj , beclamathasone 0.25 neomycin , bed sheet , bilurubin-100 test , biodentine or mta , bnc oral gel , bone cutting burr , bp aparatus , budate respules or budacart 0.5 , budate rotacap , buscopan inj , calamine lotion , calcium 500 , caldikind plus , carace 2.5 mg , cardivas cr40 , catgut 0-3 , cefexime 100mg , cefexime 200mg , chlorohexadine mouthwash , cholestrol 100 test , ciprofloxacin 500 , composite restoration , cotton 500gm , coupland elevator , creatinine 1 100 test , cyra d , cyra ls , cystone , dalcolex , darolac sachet , demelon cream , dexamathasone inj , diclofenac serritopepdase , diclofenac gel , diclofenac inj , dicyclomine 20 paracetamol , difizma rotacap , dilnip trio , diluent cell pack , disodium hydrogen syp , disp face masks , disp syringe 10ml , disp syringe 1ml , disp syringe 3ml , disp syringe 5ml , disp tissues , distill water 5 ltr , dressing pad 6 , drotoverine 80mg , drotoverine inj , e soz d 40 , ecosprin 75 , edta top , eltroxin 100 or thyronorm 100 , eltroxin 25 or thyronorm 25 , eltroxin 50 or thyronorm 50 , eltroxin 75 or thyronorm 75 , embeta am 50 , embeta xr 25 , embeta xr 50 , equirex , erba wash , esogress-40 , etoshine mr , evion 400 , examination gloves , exenta 25 , fanxima , festal n , fevoxtat 40 , fitosleo , flomist spray , floxavate 250 , folitrax 10mg , folivite 5 mg , formecresol liquid , formonide rotacap 200 mg , gasex , gemer 1 , glass slab dental , glimprex mf 2 500 , gluconorm pg1 , gluconorm pg2 , glucoryl mv2 , glucose 1 100 tests , glyco 6 , hand sanitisers , handpiece nsk , headset , humansulin 30 by 70 inj , humolog mix 50 inj , hydrocort inj , hydrogen peroxide , ibugesic plus , ibukind plus syp , iiodine povidine gargle , inj neurokind plus , insugen n 30 by 70 , insugen r , inverted cone bur , istamet 50 by 500 , iv canula 22g , iv infugen set , jupiros a , keraglo eva , lantus cart inj , levocetrizine 5mg with montelocast 4mg , levocitrizine 5 mg , levofloxacin 500mg , lignocain 2percent inj , lignocain with adreline 1 by 80000 inj , limcee , liq paraffin plus sodium picosulphate syp , liq. paraffin , liquid developer , liquid fixer , livogen z , long round ended tapered burrs , lotion povidine iodine , matrix band strip , melmet sr 500 , mepride vm 2mg , metofit am 25 , mouth mirror with handle , mycofit 360 , nasivion s nasal drop , naxdom 250 , needle destroyer , neosporine , nexto ls , nimlo at , nuerogold , oflaxacin 200 with ornidazole , oint povidine iodine , oint soframycin , olnite 20 , ometab 20 , onapar plus , ondesteron inj , ondestron 4 mg , ors , osta d3 nano , otrivin adult , otrivin paed , pantaparazole 40 , pantaparazole inj , pantocid l , pantop 40mg , paracetamol 500 , petril md , pinom ct 40 , polishing cups , pregabolin , pregabolin with mecobalmin , prgastar d , prochloroperazine 5 mg , psycogen , qamat trio 50 , reaction vessels beckman coulter access-2 , red top-clot activator pack of 100 , refresh tears eye drops , ria vials abdoss , rosovas f10 , rosovas gold 10 , round bur , ryzodeg cartrige , salbair i rotacap , self developing dental x ray film , sgot erba transasia erba , sgpt erba transasia erba , spirit 100ml , spiromont b , stethoscope , stolin gum paint , straight burr

CTN :39687839

25 Mar, 2025 NA

Kolkata - West Bengal

Tender For supply of stericool hydrogen peroxide. specification: (1) liquid sterilant hydrogen peroxide cartridge (2 ) 240 ml per pack or similar (3) product must be compatible with plasma sterilizer, getinge model- stericool (4) compatibility to be checked at the time of technical scrutiny within three days of intimation to the firm . ]

Sodium Iodide Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

Central Government/Public Sector

corporations/Associations/Others

Central Government And Public Sector