Latest glucose Tenders | Government glucose Tenders

Central Government/Public Sector

CTN :45521881

04 Jul, 2026 2.00 Lacs

Bhuj - Gujarat

Tender For supply of pharmaceuticals ltd , syp new grilintus 100 ml mfg by franco india pharma pvt ltd , syp grilinctus bm 100 ml mfg by franco india pharma pvt ltd , tab neurobion forte mfg by procter gamble health ltd , tab metrogyl 400 mg mfg by mfg by j b chemicals and pharma ltd , oint fourderm 10 gm mfg by cipla ltd , tab dulcoflex mfg by opella healthacare india pvt ltd , cipcal d3 granules mfg by cipla ltd , dettol antiseptic disinfectant liquid 60ml mfg by reckitt benchiser india pvt ltd , ear drops candid mfg by glenmark phar ltd , hansaplast antiseptic wash proof bandages , mistdress antiseptic bandage spray 75 gm , crape bandages 10 cms wide and 4 meter length mfg by tynor cure , disposable 3 ply surgical face mask , bandages roll 5 cm wide and 5 meter length mfg by bengal surgicals ltd , bandages roll seven and half cm wide and five meter length mfg by bengal surgicals ltd , bandages roll 10 cm wide and 5 meter length mfg by bengal surgicals ltd , ecg paper roll for 12 lead ecg machine make by s cure size-210 mm , ecg electrode jel 250 gm mfg by bpl , ecg paper roll for 12 lead ecg machine of bpl 9108 cardiart model size 210 mm , medgrip non woven paper tape white two and half cm , leukoplast adhesive tape 5 cm wide and 2 meter length , dispovan syringes 2 ml with needle mfg by hindustan syringes and medical device ltd , dispovan syringes 3 ml with needle mfg by hindustan by syringes and medical device ltd , dispovan syringes 5 ml with needle mfg by hindustan syringes and medical device ltd , dispovan syringes 10 ml with needle mfg by hindustan syringes and medical device ltd , romsons scalp vein set 22g , iv cannula 22 g mfg by romsons group pvt ltd , test tube glass three inch borosil mfg by any standard company , slide glass mfg by any standard company , tissue paper mfg by any standard company , microtips ten to hundred microliter mfg by any standard company , microptips hundred to one thousand microliter mfg by any standard company , disposable latex examination gloves seven inch mfg by any standard company , round spot band aid mfg by medigrip , cannula fixator mfg romsons group pvt ltd , bd vacutainer flash blood collection needle 22g , bd vacutainer needle holder white tab clavum 625 mg mfg by alkem lab ltd, tab montek lc mfg by sun pharma industries ltd, tab taxim o 200 mg mfg by alkem lab ltd, syp taxim o 30 ml 50 mg per 5 ml mfg by alkem lab ltd, syp azithral xl 100 30 ml 100 mg per 5 ml mfg alembic pharma ltd , syp augmentin duo 30 ml mfg by gsk pharma ltd, tab zerodol sp mfg by ipca lab ltd, volini gel 20gm mfg by sun phar industries ltd, tab zerodol p mfg ipca lab ltd , oint t bact 5 gm mfg by gsk pharma ltd, betadine gargle 50 ml mfg by win medicare by pvt ltd, inj dns 500 ml mfg by nirlilife healthcare , inj rl 500 ml mfg by nirlife healthcare , inj dextrose five percent 500 ml mfg by nirlife health care , inj ns 500 ml mfg by nirlife health care, tab sparolac ds mfg by j b chemical and pharma ltd , tab okacet l mfg by cipla ltd , tab drotin ds mfg by walter bushnell, inj voveran aq 1 ml dr reedy lab ltd , tab sorbitrate 5 mg mfg by abbot, tab disprin mfg by rickett benckiser , tab digene mfg by abbott, syp montair lc kid 60 ml mfg by cipla ltd , cap pan d mfg by alkem lab ltd, tab onden md mfg by alkem lab ltd , tab fdson 12 mfg by union pharma ltd, cap evion 400 mg by procter & gamble health ltd, syp onden 30 ml mfg by alkem lab ltd , syp colimex 30 ml wallpaper phar pvt ltd, inj onden mfg by alkem lab ltd , inj drotin mfg by walter bushnell , tab becosule z mfg by pfizer ltd , syp evict 100 ml mfg by //bid details 2 / 53

Central Government/Public Sector

CTN :45551698

06 Jul, 2026 NA

Samba - Jammu And Kashmir

Tender For supply of blood glucose test strip , blood groupkit , cotton , rapid diagnostic card , disposable syringe , disposable needle , ecg paper roll , ecg paper roll , hiv rdk , hbsag rdk , lancets , malaria card , rapid diagnostic card , surgical sprit , gloves surgical rubber , troponin enzyme test card , urine test strip , typhoid test kit

Central Government/Public Sector

CTN :45512256

02 Jul, 2026 NA

Gwalior - Madhya Pradesh

Tender For supply of cell biological items c c - hacat cells , hff1 cells , dmem, high glucose pyruvate , 5 uaauuucuacuaaguguagau gauccguaaguccaugacgu 3 , 5 uaauuucuacuaaguguagau cuagguaccgacguagcauc 3 , 5 uaauuucuacuaaguguagau cgaugucagcuaagccgucg 3 , 5 uaauuucuacuaaguguagau ggaacguacgugagucguag 3 , 5 uaauuucuacuaaguguagau gcuagacugacgcgaugcug 3 , 5 uaauuucuacuaaguguagau guagcgugacgcgagcuagg 3 , 5 uaauuucuacuaaguguagau acgguccgauagcggacucg 3

Central Government/Public Sector

CTN :45546655

22 Jun, 2026 NA

Lucknow - Uttar Pradesh

Tender For supply of glucose kit (god-pod) with standard for auto analyzer & semi auto analyzer-- incubation time less than or equal to 8 minutes- flow cell temperature 37c -with program sheet for olympus au - 400 [ warranty period: 30 months after the date of delivery ] ]

State Government

CTN :45491316

18 Jun, 2026 8.00 Lacs

Sikar - Rajasthan

Tender For supply of lab items - c.b.c printer roll , edta k 3 vial 2 ml double cap , esr pipte disposable with citrate bulb , ecg jelly , j.s.b. stain 1 & 11 , 3.8 sodium citrate , cappilary tube , filter paper , hb meter , n/10 hcl,hb tube , blood group kit(igg + igm). , cover slips , glass slide , widal kit , vdrl card , hiv card , urine container , urine multi strip(9 strip) sd , urine strip(alb. sugar) , pragnancy card , deionized water(dw) , tissue paper , clinic spirit , cotton roll (500gm) , syringe (2 ml, 3 mi & 5 mi available) , niddle(24 no) lencet , supplies , soup bar , dropper , abx midili (20 ltr.) , abx cleaner (1 ltr.) , abx lyse (1 ltr.) , minicalir (1 ltr.) , c.b.c. control, positive, negative , hbs ag rapid test , glucose kit liquid , blood urea liquid , creatinine liquid , bilirubin liquid , sgot liquid , sgpt liquid , alk. phasptase liquid , total protien liquid , colestrol liquid , trigelsrides(tg) liquid , hdl liquid , vldl liquid , album kit , glucometer strip , plain tube without cap) , plain tube with cap , s. ldh , tips - yellow (1-50 mc itr.) , tips - blue (1 mi.) , plastic tube rack , micro pippte stand , dropping bottle , glass beaker , oil immersion , accu-check (glucometer cell) , total albumin , 10 micro liter fix , 5-50 micro liter (variable) , 10-100 micro liter (variable) , 100-1000 micro liter (variable)

Central Government/Public Sector

CTN :45548852

25 Jun, 2026 NA

Allahabad - Uttar Pradesh

Tender For supply of glucose (liquid), 9x51ml. in per pack. (item no. 4474 (pac) of ami 2026 - 27).[quantity tolerance (+/-): 5 %age , item category : normal , total po value variation permitted: max 8 lacs ] ]

Central Government/Public Sector

CTN :45548809

01 Jul, 2026 NA

Erode - Tamil Nadu

Tender For supply of industrial disposable face mask, double layered with elastic band and nose clip to filter dust particles of 5 micron minimum, johnson and johnson make or similar. [ warranty period: 30 months after the date of delivery ][quantity tolerance (+/-): 5 %age , item category : normal , total po value variation permitted: max 8 lacs ] ]

Central Government And Public Sector

CTN :45471425

15 Jun, 2026 NA

Lumding - Assam

Tender For supply of medical boxes having medicines, consumables and oxygen cylinder etc at all railway stations - band aid strips wash proof (1.987.2 cms), povidone lodine lotion 100 ml, surgi pad 7.5 cms x 20 cm, sterile adhesive strip dressing (standard size), rubber tourniquet, roller bandages (7.5 cm x 4 mtr) gauze, triangular bandages (130cm x 90 cm x 90 cm), set of six wooden/polymer extensible splints (st. john ambulance type), antiseptic cream 25 gms, safety pin set of 10, injury card, adhesive plaster (2.5 x 4/5 metres), scissors dressing, pencil torch with batteries, oral rehydration powder, antiseptic spray dressing, cotton wool 100 gms, sterile absorbent gauze pad (7.5 x 7.5), sterilsed absorbent cotton wool (25 gms), tab. antacid, tab, paracetamol 500 mg, tab. isosorbide dinitrate (sub-lingual), anti-infammatory spray, xylometazoline nasal drop (0.1%), disposable sterile gloves 7.5", first aid box card for accountal, stethoscope, b. p. apparatus (aneroid type) with both adult cuff & paediatric cuff, digital thermometer, portable oxygen cyliner aluminium "aa" type reusable with accessories eg. flowmeter, 02 face mask with tubings - adult, paediatric, aed with 4 pads, newborn delivery kit, disposable syringes 2 cc. 5 cc, 10 ce, needles size 20 & 24, disposable iv set, saline ampoules 5 ml, normal saline plastic bottle 500 ml, 4.6 oral airway (guedel oro-pharyngeal) size: 0, 2, 4, 6ambu bag adult and child with mask, anti-spasmodic drop, anti-spasmodic syrup, chromic catgut 1-0 with cutting needle, curved artery forceps 6", diclofenac syrup, disposable spirit swabs, endotracheal tube disposable (sizes 3, 4, 5.6.7 mm), hard cervical collar, injection 2% xylocaine, injection 25% dextrose, injection adrenaline 1:1000, injection atropine | ml, injection deriphylline, injection diazepam, injection diclofenac sodium (1 ml/75 ing), injection drotaverine, injection frusemide, injection hydrocortisone 100 mg, injection ondansetron 4 mg, injection paracetamol (plastic bottle), injection pheniramine malente 25 mg, injection ranidine, intravenous cannula 20" & 24", laryngoscope with set of 3 different size blades with batteries, needle holder medium size straight, salbutamol metered dose inhaler, savlon-100 ml, scissors surgical mayos 6", silk sutures 1-0 with cutting needle, suction pump-foot/hand operated (portable) with suction catheter & 14" (catheters 10 each), syp domperidone, syp paracetamol, syp pheniramine, tab non-enteric coated aspirin 300-350 mg, tab pantoprazole 40 mg, tab. diazepuni 5mg, tab. dicyclomine hel, tab. domeperidone (dispersible tablet) 10 mg, tab. ibuprofen (400mg)/ diclofenac sodium (50 mg), tab. levocetirizine 5 mg, tah amlodipine (5 mg), toothed dissecting forceps, medium size

Central Government/Public Sector

CTN :45512021

02 Jul, 2026 9.50 Lacs

Kamrup - Assam

Tender For n hexane , n hexadecane , dipotassium phosphate k 2 hpo 4 , potassium dihydrogen phosphate kh 2 po 4 , magnesium sulfate heptahydrate e- mgso 4 .7 h2o , toluene , xylene , brain heart infusion broth , lb broth , nutrient broth , soluble starch , iodine , skim milk sm agar , d- glucose , dpph 2 2 diphenyl-1-picrylhydrazyl , 2,4,6-tris 2-pyridyl-s- triazinetptz , ferric chloride anhydrous , acetate buffer , ferrous sulfate , triton x-100 octylphenol ethoxylate , dulbeccos modified eagle medium dmem , mrs broth , mrs agar , hydrogen peroxide , glycerol , sodium chloride , potassium chloride , calcium chloride , sodium bicarbonate , methanol , ethanol , peptone powder , yeast extract powder , l-cysteine hydrochloride , magnesium sulfate monohydrate mgso4 h2o , porcine t3 triiodothyronine elisa kit , porcine t4 thyroxine elisa kit , mda malon dialdehyde elisa kit , porcine sod1 superoxide dismutase cu-zn elisa kit , porcine cat catalase elisa kit , porcine igg immunoglobulin g elisa kit , porcine il-10 interleukin 10 elisa kit , porcine cortisol elisa kit , porcine tnf- tumor necrosis factor alpha elisa kit , porcine il-1 interleukin 1 alpha elisa kit , molecular grade ethanol , ethidium bromide , agarose powder , 10 x tae buffer , pcr master mix , nuclease free water , rna extraction kit , cdna synthesis kit , histopaque , chloroform , isopropanol , trizol , microcentrifuge tubes zero point five ml , microcentrifuge tubes 0.2 ml , pcr tube strips , microcentrifuge tubes 2 ml , microtube rack , pcr tube rack , pipette tips-10 microlitre , pipette tips-200 microlitre , pipette tips-1000microlitre , pipette holder , gloves , slide storage box , cryo box , cryo tags , petridish , glass wash bottle set 500 ml , burette 50 ml , volumetric flask 100 ml , sodium hydroxide pellets 5 kg , hydrochloric acid hcl 2.5 lit , sulphuric acid 2.5 lit , nitric acid 2.5 lit , perchloric acid 2.5 lit , petroleum ether 2.5 lit

Central Government/Public Sector

CTN :45302476

16 Jun, 2026 1.31 Lacs

Ganjam - Odisha

Tender For corrigendum : supply of urea kit , sgpt kit , sgot kit , creatinine kit , glucose kit , alkaline phosphatase kit , cholesterol kit , triglycerides kit , widal kit , bilirubin kit t and d , dispo van syringe 3.0 ml , plain vacutainer , sodium fluoride vacutainer , k3 edta vacutainer , sodium citrate 3.8 percent vacutainer , micro- tips 2-200 micro lit , uristix , uric acid kit , hemocor-d with standard , surgical spirit , cardigel , labolene , abo anti sera , leishmans stain solution , glucostrip , absorbent cotton 500 gm , glass slide pic-2 , test tube glass 12x75 mm , alcohol swab , spot band-aid , mal card , disposable esr pipette , hdl cholesterol kit , dispovan needle 23g x 1 inch

Glucose Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors