Latest lactose Tenders | Government lactose Tenders

Central Government/Public Sector

CTN :39555203

01 Apr, 2025 NA

Belgaum - Karnataka

Tender For corrigendum : supply of 1. lactose ip , 2. lactose ip , 3. lactose ip , 4. lactose ip , 5. lactose ip

Central Government And Public Sector

CTN :39840013

01 Apr, 2025 NA

Pune - Maharashtra

Tender For quotation for fbs. fetal bovine serum us origin

Central Government And Public Sector

CTN :39840016

30 Mar, 2025 NA

Pune - Maharashtra

Tender For quotation for fetal bovine serum

CTN :39840299

03 Apr, 2025 1.98 Lacs

Jodhpur - Rajasthan

Tender For limited tender for various lab items @ idi and knch jodhpur-, sucrose, , raffinose, , mannose, , sorbitol, , arabinose, , dextrose, , lactose, , inositol, , dulcitol, , galactose, , xylose, , trehalose, , tcbs media (500 gm*1), , hugh and leifson media (500 gm*1), , lysine amino acid, , aragimne amino acid, , ornithine amino acid, , oxidase disc, , decarboxylase base broth (500 gm*1), , broom sticks

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39482582

08 Apr, 2025 NA

Srinagar - Jammu And Kashmir

Tender For corrigendum : supply of various reagents, at skims, soura, srinagar on one year rate contract basis. - media, agarose (low eeo), dna ladder (100 bp), dna ladder (50 bp), dna zap, rnase zap, dntps, gel loading buffer dye, glycerol (mol. biology), isoamyl alcohol (mol. biology), isopropanol (mol. biology), lysozyme (powdered), magnesium chloride (25mm), potassium acetate 3m (ph 5.2), primers, proteinase k, sodium acetate 3m (ph 5.2), sodium hydroxide (mol. biology), tae buffer (50x), te buffer, tris borate edta buffer (50x), anti a, anti b, anti ab, anti d (monoclonal), anti d (polyclonal), anti a1 (lectium), ahg coombs, anti h, bovines albumin, papain, anti c, anti c, anti e, anti e, hb prostrip, taq dna polymerase, hla positive control, hla negative control, rabbit complement lyophilized, heparin salt, density gradient sol. 10.77g/dl, dnase, mgcl2 solution (25mm), diluent, lyse, probe cleanser, glucose reagent (god pod), uristix 2 parameter, uristix 10 parameter, fetal bovine serum (fbs), pha m, trypsin (lyophilized), 25 bp ladder, sybr green, dmem media, eco 321, hinfi, mbo i, ddeli, ecor v, di-george probe (22q del), wolf-hirschhorn region probe, williams region probe, ip deletion probe, angelmann, praderwilli probe, kallman region probe, cri-du-chat region probe, snrpn region probe, fish implementation kits, probe for her 2, probe for alk, aneuploidy probes (trisomy 13), aneuploidy probes (trisomy 18), aneuploidy probes (trisomy 21), rpmi 1640 lyophilised with l-glutamine & phenol red indicator., heparin, oct (optimal cutting temperature embedding medium), oil red o , orange g (powder), microscopic immersion oil (cedar wood oil), mineral oil, pylocarpin, safranin, sodium hydroxide pellets mw 40, temed, triton x 100, trizol, trypsin 2.5% (tissue culture grade), turks fluid, tween 20, tween 80, wax (congealing point 600c), zinc dust (nitrate free), light green (powder), pilocarpire nitrate reagent, rpmi media

Central Government/Public Sector

CTN :39542639

03 Apr, 2025 1.78 Crore

Delhi - Delhi

Tender For corrigendum : providing of custom bid for services - selection of agency for supplying dairy items at 5 stadia in new delhi - "almond milk 200ml tetrapack" , atta bread , bakery cream , bread brown 400gm , "bread jumbo brown(san dwich)" , bread kulcha , bread millet , bread pav atta , bread white , burger bun , butter , butter chiplet 10 gm , butter milk , butter milk (flavoured) , butter nutrela , cheddar cheese , cheese feta , cheese slice , cinamaon roll , cooking cream , crossiant , cup cake , curd , danish roll , desi ghee , flavoured yoghurt 100gm , gulab jamun , cheese spread , ice cream (chocolate) , ice cream (strawberry) , ice cream (vanilla) , ice cream cup (chocolate) , ice cream cup(vanilla) , ice-cream (60 ml ) , ice-cream cup/stick/cone (120 ml) , jumbo white bread , khoya (1kg pack) , lactose free milk 250 ml tetra pack , milk flavoured , mayonaise , milk buffalo , milk cow , milk double toned , milk full cream , milk maid , milk powder , milk toned , motichoor laddoo(de si ghee) , mozrella cheese , muffin , multi grain bread , nutrifit , paneer packed , parmesan cheese , pav , probiotic drink , processed cheese , soya chap , soya milk 200 ml plain/flavou red , soya milk sugar free 200 ml , tofu , wheat burger bun , whipped cream , white bread , whole wheet kulcha (250 gm) , whole wheet paw buns (220 gm) , yakult (packet of 5 each)

CTN :36656323

26 Mar, 2025 NA

Mangalagiri - Andhra Pradesh

Tender For bid to ras supply of karyotyping culture medium , colemid solution in pbs , penicillin-streptomycin 10,000 u ml , phytohemagglutinin, m form pha-m , rpmi 1640 medium, powder , fetal bovine serum , giemsa stain solution , trypsin 2.5 percente, without phenol red , gurr buffer tablets , ssc 20x, rnase free , tween 20 50perscente solution

CTN :39419180

25 Mar, 2025 1.33 Crore

Pune - Maharashtra

Tender For bid to ras tender for supply of lab reagents - haematology thiazin stain concentrate dilutes in 500 ml when prepared pack of 200 ml , haematology reagent a buffer ph 6.8 concentrate dilutes in 5 ltrs when prepared pack of 30 ml , haematology eosin stain concentrate dilutes to 500 ml when prepared pack of 220 ml , haematology aeroix additive for meoh pack of 135 ml , g6pd rapid test , occult blood test rapid , rapid test for pan malaria antigen ict based for p.v and p.f , dengue ns1 igg and igm , ict based rapid test , multistix r 10 sg , keto diastix bott of 50 strips , ready to use leishman stain with buffer , cartridge no 12a for hp laserjet , taqmancopy number assay mto s 10 hs00965010_cm cat no 4400291 , taqmancopy number ref assay rnasep 750x cat no 4403326 , fg taqman gt master mix 1 ml each cat no 4371353 , pmrara quantitative rt pcr complete kit including cdna synthesis kit 100 rxns , dntp mix 1 ml , ntrk 48 rxns by diatech pharmaogenitics , idh 1 and 2 , 48 rxn by diatech pharmaogenitics , bcrabl quantitative tr pcr complete kit including cdna synthesis kit 100 rxn dntp mix 1ml , hla a ssp 20 test , hla b ssp 20 test per kit , hla dr ssp test , 20 test per kit , hla b 27 ssp 96 test , rnase decontaminant spray , bottle of 250 ml , molecular grade deionised water , light cycler 480 sealing foil pack of 100 foil , anti hla negative control 0.5 ml vial , dna molecular ladder 100 bp vial of 200 micro ltr , dnase and rnase free sterile microcentrifuge tube 1.5 ml 500 tube per pack , genomic dna extraction for hla typing with uv spectrophotometere a 260 280 ratio for ectracted dna being 1.8 and with batch certificate of analysis coa , taq polymerase 5 unit per micro lit 50 microliters vial , rabbit complement 1.0 ml vial , anti hla positive control 0.5 ml per vial , lymphoprep solution pack of 500ml , invitrogen fetal bovine serum size 500 ml , phosphate buffer saline q3 , 10x tbe buffer pack of 500 ml , micropipettes sterile filter tips for 0.2 to 10 micro ltr pack of 96 by 10 extended length tarsons , sterile terasaki plates of 72 well , rpmi 1640 bottle of 250 ml , biorad control l1 12 x 5 ml , biorad control l2 12 x 5 ml , biorad liquicheck urine chemistry control l1 pack of 12 x 10 ml , biorad liquicheck urine chemistry control l2 pack of 12 x 10 ml , bio rad lipocheck diabetic control , kit of 6x0.5 ml , cardiac marker control trilevel pack of 6x3 ml , adhesive spot bandage band aid size 1 inch , gram stain kit ready to use kit of 1000 ml each , zn stain kit ready to use kit of 1000 ml each

CTN :39668047

03 Apr, 2025 NA

Bhopal - Madhya Pradesh

Tender For tender for purchasing of chemicals in controller food and drug - list of chemicals, acetonitrile, acetic acid, ammonium formate, methanol, formic acid, nitric acid, hydrogen peroxide, magnesium sulphate (anhydrous), hydrochloric acid, c18 cleaning salt, ascorbic acid, primary secondary amine, sodium accetate anhydrous, ammonium formate, ammonium hydrate, tetra butyl ammonium hydride, tetrabutyl ammonium sulphate, methyl chloride, dansyl chrodide solution, green s, ethanol, ammonium phosphate monobasic, acetic acid glacial, methylene chloride, ethyl ether, n-hexane, toluene, ethyl acetate, potassium phosphate monobasic, ortho phosphoric acid, ammonium acetate, sodium sulphate anhydrous, alchohol ethanol, acetic acid glacial, acetone (hplc), aluminium oxide (activated), amonium solution, potassium sulphate, potassium iodide, silver nitrate, alkali blue 6b, boric acid, sodium thiosulphate, eosin 2% (staining solution), calsium chloride, carbon tetrachloride, barium chloride(dihydrate), edta, erichrome black-t, furfural, orthophosphoric acid, glycerol, hydrochloric acid, isopropanol, iso-amyl alchohol, methanol(hplc), nitric acid, petroleum ether 40-60, petroleum ether 60-80, phenolphthalein, potassium permagnate, resourcenol, sucrose, sulphuric acid, tlc plate, hplc water, dyethyle ether, chloroform, amylacitate, fehling sol. a, fehling sol. b, iodine resublimed, sodium hydroxide pellets, cyclohexane, methanol, ammonium chloride, ammonium hydroxide, murxide, pattons and readers, calcium, trifluoro acetic acid, edta disodium salt(dihydrate), name of culture media/serum/ chemical, agar base, baird parker agar base, egg yolk tel emulsion(50ml/100ml per vial), bismuth sulphite agar, bhi broth, brilliiant green bile broth 2%, buffered peptone water, cooked meat medium (rc medium), carbohydrate consumption broth, decarboxylase test medium (falkow), dextrose tryptone agar, fraser broth base, fraser selective supplement, fraser supplement, emb agar, levine, hugh-leifson medium, kligler iron agar, koser citrate medium, lactobacillus mrs agar, lactose broth, lysine iron agar, macconkey agar, motility test medium, mr-vp medium, myp agar base (phenol red egg yolk polymyxin agar base), poly b selective supplement, egg yolk emulsion(50ml/100ml per vial), modified listeria oxford agar base, colcef selective supplement, nitrate broth, nutrient broth, peptone water diluent, plate count agar, listeria identification agar base (palcam), palcam selective supplement, selenite cysteine broth, sheep blood agar base, thiosulphate citrate bile salt sucrose agar(tcbs), triple sugar iron agar, tryptone broth (tryptone water), urea agar base, xylose lysine deoxycholate agar (xld agar), tryptic soy agar, violet red bile agar, perfringens agar base, tsc selective supplement, cmf selective supplement, tryptone glucose extract, thioglycolate agar, tryptone salt agar w/1% nacl, tetrathionate broth base (w/o iodine & bg), potato dextrose agar, phenol red broth base, my 40 (osmophillic agar), acetate agar, czapek yeast (autolysate) agar, 10% lactic acid solution (10 ml/vial), ec broth, gn broth, hajna, hektoen enteric agar, lauryl sulphate broth (lauryl tryptose broth), liver broth / l-broth, modified, malonate broth, malt agar, mannitol salt agar base, glucose agar, yeast extract powder, peptone, rappaport vassilidis medium, saline nutrient agar, alkaline saline peptone water, onpg broth, bolton broth base, bolton selective supplement, violet red bile glucose agar w/o lactose, iron sulphite agar, ellners broth, willis and hobb s medium, glucose of medium, tryptone bile glucuronic agar (tbx agar), tergitol-7-agar base, ttc solution 1% (10ml/vial), macconkey broth, macconkey broth purple, simmons citrate agar, macconkey sorbitol agar, tryptone soya yeast extract broth, hicrome listeria ottaviani agosti agar, oa selective supplement, lp enrichment supplement, mueller kauffman tetrathionate broth base, chromogenic coliform agar, slantz & burtley medium, bile

Lactose Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government And Public Sector

Central Government And Public Sector

Central Government/Public Sector

Central Government/Public Sector