Get complete information related to latest Lactose Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Lactose Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Lactose Tenders.
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76
Tender For supply of reagents and chemicals to central diagnostic laboratory - kits and consumables for fully automatic biochemistry analyzer (dirui cs-400) (dedicated system pack), alp kit (456ml) (dedicated system pack), alt kit (456ml) (dedicated system pack), ast kit (456ml) (dedicated system pack), aso kit (60 ml) (dedicated system pack), bile acids kit 40 ml (dedicated system pack), total protein kit 630 ml (dedicated system pack), albumin kit 252 ml (dedicated system pack), total bilirubin kit 300 ml (dedicated system pack), direct bilirubin kit 300 ml (dedicated system pack), gamma gt kit 456 ml (dedicated system pack), amylase kit 252 ml (dedicated system pack), lipase kit 50 ml (dedicated system pack), urea kit 456 ml (dedicated system pack), creatinine kit 240 ml (dedicated system pack), microalbumin kit 50 ml (dedicated system pack), uric acid kit 456 ml (dedicated system pack), glucose kit 300 ml (dedicated system pack), g6pd kit 100 ml (dedicated system pack), hba1c kit 40 ml (dedicated system pack), hba1c lyse 100 ml (dedicated system pack), total cholesterol kit 639 ml (dedicated system pack), triglycerides kit 630 ml (dedicated system pack), hdl-c kit 164 ml (dedicated system pack), ldl-c kit 41 ml (dedicated system pack), calcium kit 240 ml (dedicated system pack), phosphorous kit 252 ml (dedicated system pack), magnesium kit 252 ml (dedicated system pack), lactate kit 30 ml (dedicated system pack), ldh kit 100 ml (dedicated system pack), crp kit (quantitative) 60 ml (dedicated system pack), rf kit (quantitative) 60 ml (dedicated system pack), ck-nac kit 60 ml (dedicated system pack), ck-mb kit 50 ml (dedicated system pack), d-dimer kit 40 ml (dedicated system pack), iron kit 312 ml (dedicated system pack), ferritin kit 32 ml (dedicated system pack), transferrin kit 50 ml (dedicated system pack), uibc kit 125 ml (dedicated system pack), urinary protein kit 240 ml (dedicated system pack), csf protein kit 240 ml (dedicated system pack), adenosine deaminase (ada) kit 54 ml (dedicated system pack), copper kit 90 ml (dedicated system pack), ceruloplasmin kit 50 ml (dedicated system pack), cholinesterase kit 153 ml (dedicated system pack), fructosamine kit 210 ml (dedicated system pack), homocysteine kit 36 ml (dedicated system pack), c3 kit 50 ml (dedicated system pack), c4 kit 50 ml (dedicated system pack), beta microglobulin kit 50 ml (dedicated system pack), lambda chain kit 55 ml (dedicated system pack), kappa chain kit 55 ml (dedicated system pack), lipoprotein (a) kit 24 ml (dedicated system pack), alpha 1 glycoprotein kit 50 ml (dedicated system pack), anti-thrombin iii kit 50 ml (dedicated system pack), cuvettes for cs-400 (segment of 20) (dedicated system pack), halogen lamp for cs-400 (dedicated system pack), seracon n 30 ml (dedicated system pack), seracon p 30 ml (dedicated system pack), seracal 18 ml (dedicated system pack), hba1c calibrator 25 ml (dedicated system pack), crp calibrator 01 ml (dedicated system pack), rf calibrator 01 ml (dedicated system pack), alkaline detergent 02 litre (dedicated system pack), acid detergent 500 ml (dedicated system pack), antibacterial po4 free detergent 500 ml (dedicated system pack), kits and consumables for urine analysers, uro color strips (10 parameter) for abbott sd urometer 120 (100 nos), uro color strips (10 parameter) for transasia erba laura (100 nos), thermal paper for abbott sd urometer 120, calibrator strips for transasia erba laura, thermal paper for transasia erba laura, kits and consumables for electrolyte analyzer (erma el-120), solution cartridge (isepak) (system pack), thermal paper for electrolyte analyzer (erma el-120), other kits and consumables, crp kit (qualitative), rf kit (qualitative), hbsag (qualitative), hcv (qualitative), widal kit, vdrl devices, pregnancy cards (hcg), strips for glucometer (accusure), lancets for glucometer, digital hb meter, strips for digital hb meter, hydrochloric acid (concentrated), hydrochloric acid (n/10), sodium hypochl
Tender For supply of 2025-26 (ami no. 33.1.11) c.l.e.d agar (cysteine-lactose-electrolyte-deficient agar) w ith bromthymol blue, dehydrated culture medium, 500 gms per pack ]