Web Analytics Made Easy - StatCounter

Lactose Tenders

Get complete information related to latest Lactose Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Lactose Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Lactose Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

Central Government/Public Sector

CTN :39555203 Due date: 01 Apr, 202501 Apr, 2025 NA
Tender For corrigendum : supply of 1. lactose ip , 2. lactose ip , 3. lactose ip , 4. lactose ip , 5. lactose ip

CTN :39840299 Due date: 03 Apr, 202503 Apr, 2025 1.98 Lacs
Tender For limited tender for various lab items @ idi and knch jodhpur-, sucrose, , raffinose, , mannose, , sorbitol, , arabinose, , dextrose, , lactose, , inositol, , dulcitol, , galactose, , xylose, , trehalose, , tcbs media (500 gm*1), , hugh and leifson media (500 gm*1), , lysine amino acid, , aragimne amino acid, , ornithine amino acid, , oxidase disc, , decarboxylase base broth (500 gm*1), , broom sticks

Central Government/Public Sector

CTN :39835162 Due date: 16 Apr, 202516 Apr, 2025 NA
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government/Public Sector

CTN :39542639 Due date: 03 Apr, 202503 Apr, 2025 1.78 Crore
Tender For corrigendum : providing of custom bid for services - selection of agency for supplying dairy items at 5 stadia in new delhi - "almond milk 200ml tetrapack" , atta bread , bakery cream , bread brown 400gm , "bread jumbo brown(san dwich)" , bread kulcha , bread millet , bread pav atta , bread white , burger bun , butter , butter chiplet 10 gm , butter milk , butter milk (flavoured) , butter nutrela , cheddar cheese , cheese feta , cheese slice , cinamaon roll , cooking cream , crossiant , cup cake , curd , danish roll , desi ghee , flavoured yoghurt 100gm , gulab jamun , cheese spread , ice cream (chocolate) , ice cream (strawberry) , ice cream (vanilla) , ice cream cup (chocolate) , ice cream cup(vanilla) , ice-cream (60 ml ) , ice-cream cup/stick/cone (120 ml) , jumbo white bread , khoya (1kg pack) , lactose free milk 250 ml tetra pack , milk flavoured , mayonaise , milk buffalo , milk cow , milk double toned , milk full cream , milk maid , milk powder , milk toned , motichoor laddoo(de si ghee) , mozrella cheese , muffin , multi grain bread , nutrifit , paneer packed , parmesan cheese , pav , probiotic drink , processed cheese , soya chap , soya milk 200 ml plain/flavou red , soya milk sugar free 200 ml , tofu , wheat burger bun , whipped cream , white bread , whole wheet kulcha (250 gm) , whole wheet paw buns (220 gm) , yakult (packet of 5 each)

Central Government And Public Sector

CTN :39744065 Due date: 18 Apr, 202518 Apr, 2025 3.91 Crore
Tender For tender for supply of chemical reageants and kits for bims belagavi - stainless-steel-slide-staining-rack-for-sinks-(24inch), sodium-hydroxide, snappak-(sodium potassium lithium ion)91809181,-for-roche-make-electrolyte-analyzer, lh(312201)-for-diasorin-liaison-chemiluminescence-analyzer, deproteinizer----for-roche-make-electrolyte-analyzer, chrome-agar, anti-her-2/erb-b2-receptor-(ready-to-use), anti-human-progesterone-receptor-(pr)-(ready-to-use), anti-human-estrogen-receptor-(er)-(ready-to-use), wooden-slide-box-(100-slide-capacity), tryptone-glucose-extract-agar, thymol-crystal, test-tube-racks-plastic-12-wells-to-hold-18mmx150mm-test-tube, test-tube-(18mm-x-150mm), spirt-lamp, sodium-thiosulphate, sodium-metabisulphite-, sodium-iodate, sodium-electrode-conditioner, scalpel-blade-with-handle, safranin., rf-system-pack---121057, rf-calish-121056, rapid-test-for-occult-blood-, plastic-funnel-large, plastic-coplin-jaras, plain-forceps-small, plain-forceps-long, phosphomoloybdic-acid, measuring-cylinder-plastic/fibre-500ml, light-green-powder, labolene-liquid, iron-alum, hscrp., hexamine, hand-saw, hamacytometer-box, gross-anatomy-probe, ertapenem-10-mcg, cryo-embedding-medium-for-cryostat, crp-xl-system-pack-erba-, crp-xl-system-pack-erba, conical-flasks-boiling-florence-fla-bottom-1000ml-(autoclavable), congo-red, chromic-acid-(chromimum-trioxide-flakes), chlinistrase-reagent-kit, beirbric-scarclet, zinc-dust, yeast-id-for-automated-culture-identification-and-ast-system, xylene/, xld-medium, xl-muticalibrator-erba-xl-system-pack, wilson-blair-agar, wbc-pippettes, wbc-diluting-fluid-, watmans-filter-paper-125mm-roundx100, watch-glass, vdrl-strips, uristicks-ab+swg, urine-keto-sticks, uric-acid-for-erba-mannheim-chembims7-semi-automated-biochemistry-analyzer, uric-acid-erba-xl-system-pack, urea-for-erba-mannheim-chembims7-semi-automated-biochemistry-analyzer, urea-erba-xl-system-pack, urea/, universal-reagent-pack-sensacore-st200-cl-electrolyte-analyzer, ultrasonic-cleaning-indicator, troponin-i-strips, tris-buffer-extra-pure, triglycerides-for-erba-mannheim-chembims7-semi-automated-biochemistry-analyzer, triglycerides-erba-xl-system-pack, tri-sodium-citrate, total-protein-for-erba-mannheim-chembims7-semi-automated-biochemistry-analyzer, total-protein-erba-xl-system-pack, total-cholesterol-for-erba-mannheim-chembims7-semi-automated-biochemistry-analyzer, total-cholesterol-erba-xl-system-pack, total-calcium-erba-xl-system-pack, tissue-paperrolls, tissue-embedding-cassette(plastic), ticarcillin/clavulanic-acid75/10mcg, ticarcillin-75mcg, thioglycolate-fluid-medium, thermal-paper-roll-suitable-for-elisa-machine, thermal-paper-roll-10.5cm, tetracycline-30mcg, test-tubes-75mmx10mm, test-tubes-100mmx12mm, test-tube-washing-brush-small, test-tube-washing-brush-big, test-tube-racks-alluminium-48wells-to-hold-75mmx10mm-test-tube, test-tube-holder-, tcbs-, super-sensitive-polymer--hrp-ihc-detection-kit-(1)-peroxide-block-(6ml-x-1),-(2)mouse-negative-control(3ml-x1),-(3)-rabbit-negative-control(3ml-x1),-(4)-stable-dab-buffer(10ml-x1)-(5)-dab-chromogen(2ml-x1)-(6)super-enhancer-reagent(1x6ml),-(7)poly-hpr-reagent(6ml-x-1),(8)-power-block(6ml-x-1)., sulphur-powder-, sulphanilic-acid, sucrose/, stuart-transport-medium, sterile-swabs-with-screw-capped-tubes, sterile-swabs-for-sample-collection, starch-soluble, staraight-and-cirved-scissors-(short), staraight-and-cirved-scissors-(long), stainless-surgical-trays-(large)-, spirit/, sodium-sulphate(na2so4)anahydrous, sodium-nitroprosside, sodium-dihydrogen-ortho-phosphate, sodium-deoxycholate, sodium-citrate-bulb-3.2%-1.8-ml, sodium-chloride-, sodium-bicarbonate, slides-, simmon-citrate-agar-medium, silver-nitrate, sgpt-for-erba-mannheim-chembims7-semi-automated-biochemistry-analyzer, sgpt/alt-hl-erba-xl-system-pack, sgot-for-erba-mannheim-chembims7-semi-automated-biochemistry-analyzer, sgot/ast-hl-erba-xl-system-pack, semen-diluting-fluid-, selenite-broth, sample-cups-product-code115777-for-trans

CTN :39668047 Due date: 03 Apr, 202503 Apr, 2025 NA
Tender For tender for purchasing of chemicals in controller food and drug - list of chemicals, acetonitrile, acetic acid, ammonium formate, methanol, formic acid, nitric acid, hydrogen peroxide, magnesium sulphate (anhydrous), hydrochloric acid, c18 cleaning salt, ascorbic acid, primary secondary amine, sodium accetate anhydrous, ammonium formate, ammonium hydrate, tetra butyl ammonium hydride, tetrabutyl ammonium sulphate, methyl chloride, dansyl chrodide solution, green s, ethanol, ammonium phosphate monobasic, acetic acid glacial, methylene chloride, ethyl ether, n-hexane, toluene, ethyl acetate, potassium phosphate monobasic, ortho phosphoric acid, ammonium acetate, sodium sulphate anhydrous, alchohol ethanol, acetic acid glacial, acetone (hplc), aluminium oxide (activated), amonium solution, potassium sulphate, potassium iodide, silver nitrate, alkali blue 6b, boric acid, sodium thiosulphate, eosin 2% (staining solution), calsium chloride, carbon tetrachloride, barium chloride(dihydrate), edta, erichrome black-t, furfural, orthophosphoric acid, glycerol, hydrochloric acid, isopropanol, iso-amyl alchohol, methanol(hplc), nitric acid, petroleum ether 40-60, petroleum ether 60-80, phenolphthalein, potassium permagnate, resourcenol, sucrose, sulphuric acid, tlc plate, hplc water, dyethyle ether, chloroform, amylacitate, fehling sol. a, fehling sol. b, iodine resublimed, sodium hydroxide pellets, cyclohexane, methanol, ammonium chloride, ammonium hydroxide, murxide, pattons and readers, calcium, trifluoro acetic acid, edta disodium salt(dihydrate), name of culture media/serum/ chemical, agar base, baird parker agar base, egg yolk tel emulsion(50ml/100ml per vial), bismuth sulphite agar, bhi broth, brilliiant green bile broth 2%, buffered peptone water, cooked meat medium (rc medium), carbohydrate consumption broth, decarboxylase test medium (falkow), dextrose tryptone agar, fraser broth base, fraser selective supplement, fraser supplement, emb agar, levine, hugh-leifson medium, kligler iron agar, koser citrate medium, lactobacillus mrs agar, lactose broth, lysine iron agar, macconkey agar, motility test medium, mr-vp medium, myp agar base (phenol red egg yolk polymyxin agar base), poly b selective supplement, egg yolk emulsion(50ml/100ml per vial), modified listeria oxford agar base, colcef selective supplement, nitrate broth, nutrient broth, peptone water diluent, plate count agar, listeria identification agar base (palcam), palcam selective supplement, selenite cysteine broth, sheep blood agar base, thiosulphate citrate bile salt sucrose agar(tcbs), triple sugar iron agar, tryptone broth (tryptone water), urea agar base, xylose lysine deoxycholate agar (xld agar), tryptic soy agar, violet red bile agar, perfringens agar base, tsc selective supplement, cmf selective supplement, tryptone glucose extract, thioglycolate agar, tryptone salt agar w/1% nacl, tetrathionate broth base (w/o iodine & bg), potato dextrose agar, phenol red broth base, my 40 (osmophillic agar), acetate agar, czapek yeast (autolysate) agar, 10% lactic acid solution (10 ml/vial), ec broth, gn broth, hajna, hektoen enteric agar, lauryl sulphate broth (lauryl tryptose broth), liver broth / l-broth, modified, malonate broth, malt agar, mannitol salt agar base, glucose agar, yeast extract powder, peptone, rappaport vassilidis medium, saline nutrient agar, alkaline saline peptone water, onpg broth, bolton broth base, bolton selective supplement, violet red bile glucose agar w/o lactose, iron sulphite agar, ellners broth, willis and hobb s medium, glucose of medium, tryptone bile glucuronic agar (tbx agar), tergitol-7-agar base, ttc solution 1% (10ml/vial), macconkey broth, macconkey broth purple, simmons citrate agar, macconkey sorbitol agar, tryptone soya yeast extract broth, hicrome listeria ottaviani agosti agar, oa selective supplement, lp enrichment supplement, mueller kauffman tetrathionate broth base, chromogenic coliform agar, slantz & burtley medium, bile

Central Government/Public Sector

CTN :39714830 Due date: 14 Apr, 202514 Apr, 2025 NA
Tender For supply of 2025-26 (ami no. 33.1.11) c.l.e.d agar (cysteine-lactose-electrolyte-deficient agar) w ith bromthymol blue, dehydrated culture medium, 500 gms per pack ]

Central Government And Public Sector

CTN :39540988 Due date: 03 Apr, 202503 Apr, 2025 21.5 Thousand
Tender For corrigendum : supply of chemicals to krims, karwar - ethyl alcohol 500ml for biochemistry (karwr), casien 500grm (karwr), sodium lauryl sulfate 500grm (karwr), methylmalonic acid 25grm (karwr), oxaloacetic acid 5grm (karwr), amido black 10b 100grm (karwr), p- dimethyl benzaldehyde 500grm (karwr), cholesterol 100grm (karwr), four-nitroaniline 250grm (karwr), demthyl amine 500ml (karwr), dimethyl sulphoxide 500ml (karwr), magnesium chloride 500grm (karwr), sodium salicylate 500grm (karwr), phosphotungustic acid 100grm (karwr), o-cresolphthlein complexone 5grm (karwr), succinic acid 500grm (karwr), eight-hydroxy quinoline 100grm (karwr), buffer capsule (karwr), brij (30 percent) 500ml (karwr), one-nitroso-2napthol 25grm (karwr), bromophenol blue 25grm (karwr), agarose medium 25grm (karwr), potassium dihydrogen orthophoshate 500grm (karwr), sodium chloride 500grm (karwr), di- acetyl monoxime 100grm (karwr), uric acid 100grm (karwr), creatinine 100grm (karwr), calcium chloride 500grm (karwr), lead oxide 500grm (karwr), cupric acetate 500grm (karwr), sulphur powder 500grm (karwr), conc .hydrochloric acid 5litrre (karwr), conc sulphuric acid 5litrre (karwr), conc.nitric acid 2.5litre (karwr), trichloro acetic acid 500grm (karwr), tris buffer 500grm (karwr), picric acid 500grm (karwr), thiosemicarbazide 500grm (karwr), tartaric acid 500grm (karwr), sulphosalycilic acid 500grm (karwr), starch 500grm (karwr), sodium dihydrogen orthophosphate 500grm (karwr), sodium pyuruvate 25grm (karwr), sucrose 500grm (karwr), sodium acetate 500grm (karwr), sodium tungustate dihydrate 100grm (karwr), resorcinol 500grm (karwr), phenyl phosphate disodium salt 25grm (karwr), potassium ferricynide 500grm (karwr), potassium sodium tartarate 500grm (karwr), potassium dichromate 500grm (karwr), phenyl hydrazine hydrochloride 500grm (karwr), pottasiun iodide 250gr (karwr), peptone 500grm (karwr), phenol crystals 500grm (karwr), oxalic acid 500grm (karwr), napthol 100grm (karwr), ninhydrine 100grm (karwr), methyl red solution 125ml (karwr), mercuric sulphate 250grm (karwr), molybdic acid 100grm (karwr), magnesium sulphate 500grm (karwr), maltose 500grm (karwr), metol 500grm (karwr), l-alanine 500grm (karwr), l-aspartic acid 100grm (karwr), leadacetate (anhydrous) 500grm (karwr), lactose 500grm (karwr), gelatin powder 500grm (karwr), ferric chloride anhydrous 500ml (karwr), formaldehyde 500ml (karwr), ethylene diamine tetraacetic acid 100grm (karwr), dipottasium oxalate 500grm (karwr), diphenyl amine 100grm (karwr), d- ribose 25grm (karwr), dexrose 500grm (karwr), dinitro phenyl hydrazine 500grm (karwr), d-fructose 500grm (karwr), calcium carbonate 500grm (karwr), coumasssie brilliant blue 25grm (karwr), chromatograph sheets 25units (karwr), chloroform 2.5litre (karwr), butanol 500ml (karwr), bromocresol green 100grm (karwr), barium chloride 500grm (karwr), amino acid kits (24nitem) 2box (karwr), iso-amyl alcohol 500ml (karwr), acetic anhydrous 500ml (karwr), alpha-keto glutaric 25grm (karwr), four-amino antipyrine 100grm (karwr), l-ascorbic acid 500grm (karwr), ammonium persulphate 500grm (karwr), one amino, 2-napthol,4-sulphonic acid 100grm (karwr), maglumi trop-i (karwr), maglumi ck-mb (karwr), fully automated analyser (xl) amylase 5x11ml (karwr), fully automated analyser (xl) d-dimer control( r1-5x1ml, r2- 5x1ml) (karwr), fully automated analyser (xl) ferritin control(1x1ml) (karwr), fully automated analyser (xl) crp control (1x1ml) (karwr), fully automated analyser (xl) ferritin with calibrator (r1- 2x14.5ml ), r2- 2x7.7ml (karwr), fully automated analyser (xl) d-dimer with calibrator( r2-1x4 ml) (karwr), sodium bisulphate 500gm (karwr), benzidine reagent 500ml (karwr), nitric acid 2.5l (karwr), acetone 2.5 l (karwr), sodium sulphite 500gm (karwr), sodium hypobromite 500ml (karwr), silver nitrate 500gm (karwr), sodium bisulphite 500gm (karwr), sodium hydroxide pellets 5 kg (karwr), sodium carbonate 500gm (karwr), glacial acitic acid 500ml (karwr), iodine 1

State Government

CTN :39372273 Due date: 01 Apr, 202501 Apr, 2025 1.54 Crore
Tender For corrigendum : rate contract for consumable/non-consumables items for microbiology department, rajiv gandhi super speciality hospital, delhi-110093 - dehydrated media, macconkey agarw/o cv, nacl w/ 0 .5% sodium taurocholate(500g/box), brain-heart infusion base(500g/box), blood agar base(500g/box), muller hinton agar base, cation adjusted(500g/box), colistin sulfate salt(1 gram), potassium dichromate(1 kg), peptone powder(500 gram), sulphuric acid(5 ltr), cled (cystein lactose electrolyte deficient)with bromothymol blue indicator(500g/box), peptone (bacteriological) water(500g/box), chromogenic candida agar(500g/box), sabouraud dextrose agar( sda)with chloramphenicol and cycloheximide antibiotics(500g/box), sabouraud dextrose agar( sda)without antibiotics(500g/box), macconkey broth purple with bromocresol purple(500g/box), macconkey broth purple (double strength) w/ bromocresol purple(500g/box), nutrient broth(500g/box), chrom candida differential agar(100 gm), mueller hinton broth with 2 control cations(100 gm), triple sugar iron agar(500gm), simmon s citrate agar(500gm), lab consumables, whatmann filter paper no.1, nichrome loop holderloop holder made of stainless steel rod with heat resistant handle, double wound nichrome loopcalibrated to 1 l, double wound nichrome loopcalibrated to 0.01 ml, double wound nichrome straight wire for inoculation, glassware, frosted end glass slide1. 75mm 25mm 1 mm2. thickness 1.25 0.1mm(1 box=50 slides), glass slide1. 75mm 25mm 2. thickness 1.25 0.1mm(1 packet of 10 grams), cover slip1. 22mmx22mm2. thickness: 0.13mm to 0.16mm(1 packet of 10 grams), test tubes(borosilicate glass) without rim 20mm 150mm, test tubes(borosilicate glass) without rim 12mm 75mm, conical flaskgood quality, flat bottom(500 ml), conical flaskgood quality, flat bottom (1000ml), glass measuring cylinder(100ml capacity), good quality petri dishplastic, disposable, sterile 90 15mm individual packed, glass beaker(500 ml capacity), glass beaker(250 ml capacity), glass measuring cylinder(250ml capacity), glass measuring cylinder(500ml capacity), reagent, carbol fuchsin (ziehl-neelsen)(125ml), 20% h2so4,(500 ml), conc. h2so4(500 ml), acetone(500 ml), crystol violet(25 gram), immersion oil for microscopy(125 ml), potassium hydroxide pellets(500g/box), oxidase discs(50 discs), stained salmonella antigen (to, th, ah, bh) with positive and negative controls for slide agglutination test, lugol s iodine(500 ml), kovac s indole reagent(100 ml), swab, sterile cotton swab with wooden stick1. size 150 x12mm diameter.2. individually packed. , sterile cotton swabs in hdpe tube1. cotton bud with polypropylene stick2. size:150x12mm diameter tubes3. individually packed, sterile swabs1. viscose bud with wooden stick2. size 150 x2.5mm3. individually packed ( gamma sterilized), plasticware, sterile disposable loop1. sterile disposable inoculating loops (4.4 mm diameter calibrated to 0.01ml)2. individually packed, micropipette tips 2-20 l, micropipette tips 20 -200 l, micropipette tips 200-2000 l, elisa plate(50 plates), centrifuge tubes(plastic, 15 ml capacity, screw caped, graduated), microcentrifuge tubeshould be 1.5ml, sterile, polypropylene tube with screw cap.(1.5ml), aerosol barrier tips 2-20 lpolypropylene, gamma irradiated sterile and certified rnase/dnase free, human dna free and pyrogen free, aerosol resistant tips having a hydrophobic, self-sealing barriers., aerosol barrier tips 20-200 lpolypropylene, gamma irradiated sterile and certified rnase/dnase free, human dna free and pyrogen free, aerosol resistant tips having a hydrophobic, self-sealing barriers., aerosol barrier tips 100-1000 lpolypropylene, gamma irradiated sterile and certified rnase/dnase free, human dna free and pyrogen free, aerosol resistant tips having a hydrophobic, self-sealing barriers., cryovialssterile self standing tight screw cap closures to prevent liquid leakage ,certified rnase/dnase free, human dna free and pyrogen free(2ml), antisera, salmonella polyvalen

CTN :39644375 Due date: 03 Apr, 202503 Apr, 2025 NA
Tender For two year rate contract for supply of consumables and reagents items (3rd call) at microbiology department aiims raipur. - consumables and reagents for microbiology department:, mueller hinton agar (pack size 1 x 500 g) , nutrient agar (pack size 1 x 500 g) , cled agar with bromo thymol blue (pack size - 1 x 500g), brain heart infusion broth (pack size - 1 x 500g), peptone water (pack size - 1 x 500g), sabouraud dextrose agar (pack size - 1 x 500 g), triple sugar iron agar (pack size - 1 x 500 g) , phenylalanine agar (pack size - 1 x 500 g) , dnase test agar (pack size - 1 x 500g) , bile esculin agar (pack size - 1 x 500g), corn meal agar (pack size - 1 x 500g), christensen urea agar base (pack size - 1 x 500g), buffered glucose phosphate broth (pack size - 1 x 500g), hugh leifson medium (pack size - 1 x 500g), moeller decarboxylase broth base (pack size - 1 x 500g), nutrient gelatin (pack size - 1 x 500g), xld agar (pack size - 1 x 500g), tcbs agar (pack size - 1 x 500g), fluid thioglycollate medium (pack size 1 x 500g), mueller hinton agar with 2% glucose & methylene blue (pack size - 1 x 500g), potato dextrose agar (pack size - 1 x 500g), gram iodine (pack size - 1 x 500ml), bacitracin disc (pack size - 1 x 50 disc), sheep blood agar plate (pack size - 1 x 50 plates), dca (pack size - 1 x 500g), chloramphenicol (pack size - 1 x 5g), dmso (pack size - 1 x 250 ml), rpmi 1640 agar w/ mops & 2% glucose w/o sodium bicarbonate (twin pack) (pack size - 1 x 500g), paraffin liquid, light (pack size - 1 x 500ml), penicillin g disc (pack size - 100 disc x 5 vl), azithromycin mic (0.016-256mcg/ml) (pack size - 1 x 30 strip), ampicillin mic strip- 0.016-256mcg/ml (pack size -1 x 30 strip), vancomycin mic strip range- 0.016-256mcg/ml (pack size 1 x 30 strip), ceftriaxone mic strip range- 0.016-256mcg/ml (pack size - 1 x 30 strip), penicillin mic strip range- 0.016-256mcg/ml (pack size - 1 x 30strip), ciprofloxacin mic strip range- 0.016-256mcg/ml (pack size - 1 x 30 strip), levofloxacin mic strip range 0.002-32 mcg/ml (pack size - 1 x 30 strip), ceftazidime mic strip range 0.016-256mcg/ml (pack size - 1 x 30 strip), ticarcillin/ clavulinic acid mic strip range 0.016-256mcg/ml (pack size - 1 x 30 strip), micafungin mic strip 0.002 - 32 mcg/ml (pack size - 1 x 30 strip), caspofungin mic strip 0.002 - 32 mcg/ml (pack size - 1 x 30 strip), hi-flexi loop 4 (pack size - 5 x 100 no.), sterile cotton swab with wooden stick (pack size - 1 x 500 no.), hi-dispo bag- 12, size- 12 (h) x 10 (b), holding cap- 1kg, multiple packing of 50 bags (pack size - 1 x 500 no.), l- arginine mono-hydrochloride (pack size - 1 x 100g), l- ornithine mono-hydrochloride (pack size - 1 x 100g), n-acetyl-l- cysteine (pack size- 1 x 25g), potassium dihydrogen orthophosphate monobasic hi ar (pack size - 1 x 500g), di- sodium hydrogen phosphate anhydrous hi-lr (pack size - 1 x 500 g), tri-sodium citrate dihydrate hi-lr (pack size - 1 x 500g), sodium hydroxide pellets hi-lr (pack size - 1 x 500g), magnesium citrate tribasic anhydrous (pack size - 1 x 500g), tween 80 (pack size - 1 x 500 ml), durhams tube (pack size - 1 x 100 no.), disposable petriplate 90 mm (pack size - 1 x 600 no.), mccartney bottles w/ aluminium cap (pack size - 1 x 100 no.), lugols iodine (pack size - 1 x 125 ml), alberts metachromatic stain kit (pack size - 1 x 100ml), giemsas stain (pack size - 1 x 100 ml), l-arabinose (pack size - 1 x 100g), d-glucose (pack size - 1 x 500g), d-mannitol hi-lr (pack size - 1 x 500g), sucrose ar (pack size - 1 x 500g), d-maltose monohydrate (pack size - 1 x 100g), lactose monohydrate hi- ar (pack size - 1 x 500g), actidione (pack size - 1 x 1g), mueller hinton broth (pack size - 1 x 500g), sodium taurocholate (pack size - 1 x 500g), inhibitory mold agar (pack size - 1 x 500g), maconkey agar w/o cv, nacl w/ 0.5% sodium taurocholate (pack size - 1 x 500g), cooked meat medium (revised as cooked m medium) (r.c.medium) (pack size - 1 x 500g), hichrome candida different
 Loading, Please wait...

Connect us via What's Up