Latest lactose Tenders | Government lactose Tenders

Central Government/Public Sector

CTN :39555203

01 Apr, 2025 NA

Belgaum - Karnataka

Tender For corrigendum : supply of 1. lactose ip , 2. lactose ip , 3. lactose ip , 4. lactose ip , 5. lactose ip

CTN :39858836

18 Apr, 2025 NA

Tawang - Arunachal Pradesh

Tender For supply of cement 43 grade opc , coarse sand free from vegetation , coarse aggregate 20mm graded , coarse aggregate 40mm graded , hardcore 63 to 90 mm graded , aac blocks of size 600x200x150mm , mild steel bars of size 8 mm dia , mild steel bars of size 10 mm dia , mild steel bars of size 12mm dia , mild steel bars of size 16 mm dia , ms binding wire , wooden plank for shuttering ii class wood of size 3.0 x0.3 x0.026 m , acrylic emulsion paint of approved brand on new concrete surface , wooden scantling various size , oil bound distemper washable quality , wooden log for prop , synthetic enamel paint , painting brush 4 inch , nails various sizes , ms rhs of size 96x48x4 , ms plate of size 8mm thick , ms nuts and bolts of length 100mm fully thread suitable for 10 mm dia , ppgi sheet 0.55 mm thick of size10ft x3 ft , ppgi ridge sheet of 0.63mm thick of 90cm wide , self taping steel screw half thread with rawl plug , hdpe sand bags og colour of size 0.75x0.375x0.15 , anti corrosive red oxide zinc chromate primer , white lime , waterproofing compound , cement based paint , door of size 3x2.1 mtr double leaf , ventilator with grill 600x450mm , birla white wall care putty , ceramic tiles of size 600x600mm , white cement , curtain arrangement , movable pvc panel 12mm thick , app based polymeric membrane , priming surface and applying bitumen , brick sub class b , three phase 1.2 hp monoblock pump 430 volt complete , mild steel bars of size 12mm dia , air termination single pointed aluminium rod 12 mm dia and 300 mm long , testing point terminal block make of gun metal , aluminium strips 25 x 3.0 mm , galvanized iron strip 32 x 6 mm , earthing plate 600 x 600 x 6 mm , charcoal , salt normal , ci earth pit cover of size 300 x 300 x 6 mm , nut bolt 6mm dia 30 mtr dia with check nut and washer , gi pipe 40mm dia mtr 2.5 mtr , insulating pvc block 75x75x30 mm with insulating clamp nut and bolt , cement opc 43 grade packed , coarse sand free from vegetation , coarse aggregate 40mm graded , stone boulder 99 inch to 12 inch , pvc pipe 75mm dia 3 mtr long , distribution box 8 way double door spn 240 volts , mcb spn 240 volts 32 amps , mcb sp 240 volts 6 to 32 amps , pvc tape 19mm wide 5m long , cable pvc insulated electric 1.5 sqmm single core , cable pvc insulated of size 2.5 sqmm single core , cable pvc insulated 4 sqmm single core , pvc casing capping 1 inch , pvc casing capping 3 by 4 inch , switch piano type 5a 230v flush type one way , led tube light fittings 15w 230v , led mirror lights 1 feet 5 watts , screw 6x19mm isi marked , pvc switch board 6 inch by 6 inch , pvc switch board 7 inch by 4 inch , pvc switch board 8 inch by 10 inch , pvc l bend and t , modular switch socket combination 15a 230v , service bracket 40mm dia , service cable insulated aluminium conductore 10 sqmm 2 core , ceiling rose three terminal , led bulk head fittings high pressure die cast , pvc flexible wire copper conductor multi strandard , pvc flexible conduit pipe 15mm dia , pvc round or square block , exhaust fan of 230 volts 300mm seeep , fire exitingusher of 1kg capacity of dry powder type , earthing plate 600x600x6mm gi , ci earth pit cover of size 300x300x6mm with angle iron , funnel fitted with 20mm dia gi pipe 1.5m long , gi wire 4mm dia for earthing. , charcoal. , salt normal. , individual standalone plastic body smoke alarm , individual standalone plastic body heat alarm , fire ball extinguisher of 1.3 kg wt , study chair of size length 56 cm , study table , looking mirror of selected quality frameless , bid details/ 2 / 70 peg set of six , water dispenser of 230 v 500 watts , manual kero room heater 60cm height , labour charge

CTN :39852377

14 Apr, 2025 10.00 Lacs

Sagar - Madhya Pradesh

Tender For inviting rates for construction material supply for financial year 2025-26 - inviting rates for construction material supply for financial year 2025-26, boulder with spreading 0.75 to 20 c.m., fata with spreading rubble stone, soft murrom with spreading, hard murrom with spreading, bajra with spreading, course sand sand, fine sand barman sand, crusher stone duststone dust, 06 mm metal crushed. metal, 12 mm metal crushed. metal, 20 mm metal crushed. metal, 40 mm metal crushed. metal, 90 mm metal crushed. metal, flag stone 50 mm to 100 mm thick flag stone, flag stone 150 mm to 200 mm thick dasa, bricks (fly ash)8 x 4 x 4, bricks (local)9 x 4 x 3, half round r.c.c. pipe150mm dian.p.-2, half round r.c.c. pipe250 mm dian.p.-2, half round r.c.c. pipe300 mm dian.p.-2, half round r.c.c. pipe450 mm dian.p.-2, r.c.c. hume pipe300 mm dian.p.-3, r.c.c. hume pipe450 mm dian.p.-3, r.c.c. hume pipe600 mm dian.p.-3, r.c.c. hume pipe1000 mm dian.p.-3, r.c.c. hume pipe1200 mm dian.p.-3, r.c.c. cement pole2.40 m hight, r.c.c. cement pole3.0 m hight, barbed wire steel9.38 k.g. per 100r. m., wire mesh (steel)50x50 mm strengthing 4mm with nut bolt baser, angle iron all size mild steel, steel bar all size up to 25 mmmild & torsteel, winding wire, stainless steel febrication work with fixing labour charge, steel door & windows with all fittingsangel iron 30x30x5 mm flat iron 25x5 mm sheet 18 gauge, collapsible shutter with all fitting (steel), iron chamber/drain grill (complete spot fitting with labour), corrogated g.i. sheet0.63 mm0.63 mm, cement p.p.c. isi markisi mark 50kg beg, cement o.p.c. isi markisi mark 50kg beg, centring shutering with fitting and cartling below plinth level, centring/shutring with fitting & cartingabove plinth level, putty double coat with finishinglabour, roller machine with diesel & operetor, 16 to 18 mm thik plan white marble/green marble/zebra black marble/red marble, 25mm thick kota stone, 16 to 18 mm thick granite stone of any colour and shade, vetrified tiles60 x 60 cm 10mm thick 15:15622, glazed tiles300 x 300 mm 10 mm thick 15:15622, tiles / marble fitting labour charge, pvc floor carpet, w.c. 580 x 440 mm with footrest & p-trap with fittingodisa petarn, w.c. european type with fittingisi marked white solid plastic seat and lideuropean type, w.c. european type with fittingisi marked black solid plastic seat and lideuropean type, chequr tiles with fitting18 to 20mm thick ordnory cement, m.s. tube steel frame febrication work including all fitting labour charge, m.s. angle steel frame febrication work including all fitting labour charge, providing and laying cement concrete m20 grade work with required & equipmentlabour, aluminium fram work complete (glass/acp sheet/grill), hydra machine, poclain machine, water proofing treatment on roofs of slab by cement slurry mixed with water proofing compound complete, wall painting with plastic emulsion paint of approved paint, removing white or colour wash by scrapping and sand papering complete, distempring with oil bound distamper water proof paint complete, repairs to plaster of thickness 12 mm to 20 mm in patches of area 2.5 sq mm including cutting the patches in propper shape, providing & fixing granite bhumipujan / lokarpan patthar with photo and writing work complete, providing and fixing on wall wallpaper complete, providing and fixing 12 mm toughened glass with accessories labour fitting complete, providing ply 19 mm thick, providing and fixing mica sheet complete, providing carpentar for furniture work, providing and fixing 60 mm thick paver block 30 n/sqmm, brick masonary work with open bhatta complete, statue colour paint complete

CTN :39850456

11 Apr, 2025 NA

Saharsa - Bihar

Tender For purchase and installation of practical equipment in various educational institutions under saharsa district - moving coil galvanometer , moving coil voltmeter , moving coil ammeter , micro ammeter , sonometer , apparatus to determine relationship between the frequency and tension, length & mass , battery eliminator , tunning fork electrically , apparatus to investigate standing waves on a string. , meter bridge , experiment to determine the unknown resistance of a conductor. , potentiometer experiments to measure the internal resistance of a cell. , deflection magnetometer experiments to measure the deflection of a compass needle by magnetic field , tangent galvanometer apparatus for measurement of the direction & power of current , dry cell , analytical digital weighing scale , bar magnate 50mm, m name , u magnate , mirror fl 4 concave 50mm , mirror convex 50mm , mercury thermometer c/f/r , micrometer screw gauge 15mm , apparatus to measure the dimensions of object with high precision. , eliminator 4amp , meter bridge 100cm long , friction apparatus , dcc copper wire insulated , glass slab 75x50x18mm , lenses concave 50mm , lenses convex 50mm , measuring cylinder 500ml poly to measure the volume of liquid , double disc spherometer , apparatus curvature to measurement of radius of , vernier calipers apparatus to studying expansion of material, charts of newton's second law , charts of ohms law , charts of electro magnate , charts of telescope , charts of reflection of light , charts of refraction of light , charts of newton's law of motion , charts of 4 stroke engine , charts of electron microscope , charts of magnate , mirror stand metallic adjustable , pin stand adjustable metallic , tripod stand , measuring cylinder graduated poly 500ml , beaker borosilicate 250ml , rheostat , apparatus to variable change of resistance , lechlanche cell , stop clock , equilateral glass prism 50mm , magnetic compass both side glass , zinc plate with terminal , copper plate with terminals , zinc rod with terminal , manganine coil resistance box 100.ohms , magnesium metal ribbon coil, analytical digital weighing scale , test tube stand , holder hold for glass wares , burette clamp , tripod stand to support glassware , measuring cylinder graduated poly 500ml , beaker borosilicate 250ml , gas jar with cover 6x2 , conical flask 250ml , round bottom flask 250ml , flat bottom flask 250ml , reagent bottle 250ml poly , reagent bottle 500ml poly , wash bottle 250ml , test tube 5x1/8 , measuring flask 250ml , pipette 10ml , filter paper 100.circle 12.5 cm dia. whatsman's , test tube holder, tongs , test tube brush , spirit lamp , spatula , conical funnel 75mm , digital conductivity meter , chemical weight box , desiccators with lid glass , atomic model sets , bunsen burner , motor & pestle(porcelain)-3" , beehive shelves(porcelain)-3" , crucible with lid , red litmus paper , blue litmus paper, chart of hydrogen gas , structure of atom , chemical bonding , manufacturing of soap , rutherford atomic model , charts of water purification , charts of bleaching powder manufacturing , charts of nuclear energy , charts of petroleum , sodium hydroxide , phenolphthalein indicator solution , methyl orange indicator solution , sodium carbonate , sodium bicarbonate , calcium chloride , calcium carbonate , ferrous sulphate , blue litmus paper , red litmus paper, compound microscope , apparatus for viewing samples at high magnification. , dissecting microscope , low power microscope , staining rack , empty jar specimens with cover , mounting slides , cavity slides , beaker 500ml pp , beaker 250ml pp , conical flask 250ml borosilicate , conical flask 500ml borosilicate , wash bottle poly 250ml , f.b. flask 250ml borosilicate , test tube borosilicate 150x25mm , measuring cylinder poly 250ml , reagent bottler 250ml poly , petri dish , watch glass 75mm , cover slip , ph paper , test tube stand, charts: human skeleton system , , human nervous system , human hea

CTN :39840299

03 Apr, 2025 1.98 Lacs

Jodhpur - Rajasthan

Tender For limited tender for various lab items @ idi and knch jodhpur-, sucrose, , raffinose, , mannose, , sorbitol, , arabinose, , dextrose, , lactose, , inositol, , dulcitol, , galactose, , xylose, , trehalose, , tcbs media (500 gm*1), , hugh and leifson media (500 gm*1), , lysine amino acid, , aragimne amino acid, , ornithine amino acid, , oxidase disc, , decarboxylase base broth (500 gm*1), , broom sticks

CTN :39835337

16 Apr, 2025 NA

South Andaman - Andaman And Nicobar Islands

Tender For supply of cable lugs,cable tie,cable tie,cable tie,insulation tape,star delta timer,winding temperature relay,06mm nut bolt,battery terminal,wraping polythene cover,control battery,2core cable,3core cable,8mm nut bolt,heat sleave,capacitor,voltage monitoring relay,supply montoring series,glass fuses,glass fuses,glass fuses,glass fuses,glass fuses,phase failure relay,general purpose grease,jublee clamp02,jublee clamp03,jublee clamp04,durretes02,durretes03,durretes04,m seal,grease gun,tool box set,socket set,screw driver set,general purpose hand pump,hp tullu pump,pressure gauge bar,compound gauge bar,metal putty,allen key set,allen key set,cotton waste,cutting pliers,grip pliers,belt spanner,pipe wrench,pipe wrench,scraper,screw driver big,screw driver big,multimeter,2 ft led tube light,flood light,cross pin led,square type led light,pin type led,thread type led,ss nut and bolt,ss nut and bolt,ss nut and bolt 3 lenght,ss nut and bolt 3 lenght,ss nut and bolt,ss nut and bolt,bearing de,bearing nde,circlip,gasket for pump

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

State Government

CTN :39474899

16 Apr, 2025 NA

Kheda - Gujarat

Tender For corrigendum : supply of miscellaneous consumable for emd-7 department at gsecl,wtps - self fusing rubber tape black , class b , 31 kv die electric strength , size 2.5 cm x 10 mtr., ht pvc insulation tape size 0.18 mm x25 mm x 65 mtr length, pvc insulated copper unshethed flexible wire 1.5 sqmm,1100 v, godrej make 7 lever door lock, pvc insulated, unsheathed flexible copper cable size 1 core x 2.5 sq. mm, 1100 v grade, champion make teflon tape @ 1/2" size, nylon braided pvc hose pipe suitable air/water handling ;at working pressure of 10kg/cm2 size-20mm, polyester webbing sling, swl 5000 kg x 3 mtr, impact wrench power/battery operated, cordless screw driver power/battery operated, flat cable 3 corex4 sqmm with copper conductor for submersible motor, cello tape brown colour, nylon braided pvc hose pipe suitable air/water handling ;at working pressure of 10kg/cm2 ,size; 12mm, painting brush size 3" (75 mm), painting brush size-38 mm, allen key set of size : 1/16" (inch) to 3/8" (inch), allen key set of size 1.5 to 10 mm, rusting clean brush, wire brush flat 2.1/2", rusting clean brush, wire brush round 1.1/2", thinner for enamel paint. (tin of 1 ltr.), combination plier with ca sleeve 1621-8,210 mm, gun metal gate valve size 15 mm (1/2"), is-778, class-i, screwed female end., puff seal have polyurethene based foam sealing compound, plastic dori (sutari) for binding of plastic ,0.5 thick &2mm width., painting brush size 4" (100 mm), hand drill machine size 13mm, britelite 1200 meters long rang torch rechargeable led flashlight with charger., 2 switch + 2 plug wooden board with top sunmica, silica gel blue 4 to 6 mm, drill bit set it/addision,size;2 mm to 10 mm., apcolite synthetic enemel cascade green paint, red oxide, pvc hand gloves acid/alkali proof size 16" (yelow colour), esab earthing clamp, washing powder ( 1 kg pack ), transparant tumbler 1 ltr, pvc buckets-15ltr, 3 core , 6 mm sq. flexible pvc insulated copper cable, painting brush size 2" (50 mm), self adhesive pvc electric insulation tape rolls with isi mark size 1.80 cm width x 7.5 mtr length x 0.125 mm thickness, of red colour, self adhesive pvc electric insulation tape rolls with isi mark size 1.80 cm width x 7.5 mtr length x 0.125 mm thickness, of yellow colour, self adhesive pvc electric insulation tape rolls with isi mark size 1.80 cm width x 7.5 mtr length x 0.125 mm thickness, of blue colour, self adhesive pvc electric insulation tape rolls with isi mark size 1.80 cm width x 7.5 mtr length x 0.125 mm thickness, of black colour, self adhesive pvc electric insulation tape rolls with isi mark size 1.80 cm width x 7.5 mtr length x 0.125 mm thickness, of green colour, m seal general purpose fast curing compound, acetone, dr. back make backtol red in 1 lit. tin varnish, rustolene, brilliant white paint, light gray paint size 4 liters light gray paint size >> 1 liter.

CTN :39824127

23 Apr, 2025 NA

Satna - Madhya Pradesh

Tender For invitation of rates equipment/tools - invitation of rates equipment/tools, abc fire extinguisher 12 kg (map 50), abc fire extinguisher 1kg (map 50), abc fire extinguisher refilling (map 50) refilling, abc fire extinguisher 2kg (map 50), abc fire extinguisher 4kg (map 50), abc fire extinguisher 6kg (map 50), abc fire extinguisher 9kg (map 50), adjustable wrenches 27no., adjustable wrenches all type (upto 27 no.), air blower (620w, 16000 rpm, air flow 3.5 cum/min, anti vibration) (heavy duty), allen key set, angle cutter (heavy duty) (11000 rpm), axe large (heavy duty), b.a. set refilling, battery charger machine (12/24v, upto 10 amp, 70 ah to 220 ah) portable (heavy duty), multi bank charger, battery operated grease gun 480w 10,000 psi, bolt cutter 350 mm, bolt cutter 600 mm long(heavy duty), bolt cutter 900 mm long(heavy duty), breaker (1000 blow/minute, 2000w.), canvas gloves with anti skid palm (heavy duty), cap hydrant spindle (heavy duty), car stopper/speed breaker, chheni 1 kg steel (heavy duty), chheni 1.5 kg steel (heavy duty), clamp (0.5 ,0.75,1,1.25, 1.5,1.75, 2,2.25, 2.5, 2.75, 3,3.25, 3.5, 3.75 , 4 inch) complete set, claw hammer 1.5 lb (ss), co2 fire extinguisher refilling, co2 fire extinguisher 1kg, co2 fire extinguisher 2kg, co2 fire extinguisher 4kg, co2 fire extinguisher 6kg, co2 fire extinguisher 9kg, combi tools hydraulic (spreading force 23 ton, cutting force 43 ton), combined key for hydrant cover and lower valve, crow bar 6 ft. (heavy duty), crow bar of 6 ft long 25mm dia, cutter stone (heavy duty), delivery hose 63mm dia confirming to (type a 15 mtr length) with ss metal and female coupling, delivery hose 63mm dia confirming to (type a 30 mtr length) with ss metal and female coupling, delivery hose 63mm dia confirming to (type b 15mtr length) with ss metal and female coupling, delivery hose 63mm dia confirming to (type b 30mtr length) with ss metal and female coupling, digging bar(heavy duty) 5kg, double side box end wrench ss (12-13, 14-15, 16-17, 23-26, 24-27) complete set, drill machine electric 500watt 2600rpm with all type of drill bits set, electric chain saw machine (heavy duty) 16 inch bar,800w, electric circular saw 1400 watt, electric tool kit (megnetic bit holder, long nose plier, vu inch adapter pller 1x4, socket wrench, cutter hammer, wood drill bits x5, masonry drills bitsx5, wrenchsx7, allen keysx8, hix bitsx10 ), fire beater ms 5kg, fire blanket 5mtrx5mtx4mm (heavy duty) asbestos, 900 degree c, fire cylinder painting work, fire fighter cap (heavy duty), fire fighter winter jacket (heavy duty), fire fighter uniform (suit), fire fighting safety shose/boots (heavy duty), fire net (3m x 10m) (heavy duty), fire safety helmet with tourch facility(heavy duty), fire vehicle ladder 24 feet (aluminium), fire vehicle ladder 30 feet (aluminium), fireman axe (heavy duty), first aid box, floodlight led work light 18 v, foam branch-fb5x type with pick up tube, gm, foam tubes (length 14 inch), foam tubes (length 16 inch), fog nozzle 63 mm, gunmetal, folding ladder aluminium 15 feet (heavy duty), full face mask, g clamp 100mm, goggle- (heavy duty), grinding stone 4 inch,metal (heavy duty), hacksaw 390mm x 23mm x 150mm (heavy duty), hammer - 10 kg, hammer 1 kg (ss), hammer 2 kg (ss), hammer 3 kg (ss), hammer- 5kg, hand controlled branchpipe gm 63mm, hand cross saw 18 inch steel (heavy duty), high expansion foam branch pipe 63mm gm, high expansion foam compound, high velocity nozzle 63 mm gunmetal, hook ceiling (preventor) with 3 mtr long wooden handle(heavy duty), hose bandages, hose box (for storing two nos 7.5m or 15m hoses and one nozzle), hose rack asssembly, hose reel 19mm heavy duty (30 m), hose reel drum ms, hose reel nozzles bronze inch, hydraulic bolt cutter electric 950 w cutting diameter 20mm, hydraulic grease gun with all nozzle set 9gm/stroke, 10 kg, heavy duty,4000 psi, hydraulic rebar cutter (14 ton)(manual), impact wrench tyre nut opener,4200 rpm(with nozzle of 27no.30no.32no.), jack hydraul

CTN :39605716

29 Mar, 2025 NA

Imphal - Manipur

Tender For corrigendum : supply of spring balance , magnetic compass , set of three resistors 5 ohm 10 ohm and 15 ohm , measuring cylinder , bar magnet , ring magnet , disk magnet , u shaped magnet , aluminium pipe , slinky , one way key , laboratory , stand , assembly , ms rod , boss head , base , clamp , connecting wire crocodile clips , connecting wire banana clips , metal cylindrical with hook , pendulum ball with hook , split rubber cork , thread , concave mirror , convex mirror , lens double convex , lens double concave , prism , glass slab , plano concave , double convex lens , half cylindrical lens , cell holder , copper strip , enameled cupper wire , nichrome wire , nichrome wires , dia 55mm 24swg , dia 43mm 27swg , dia 38mm 28swg , constantan wire , multicore flexible insulated electric copper wire , 250g weight with hook , ray steak box , protector half , plane mirror strips , beaker 50ml , stirrer , multimeter with battery , laboratory thermometer , perspex lens holder , screen holder , candle holder , wooden scale optical bench , screen , candle , thumb pins , sand paper , pulley with frame rod , plastic box big , plastic box small , stopclock mechanical , kit box , compass , plastic strip a type , plastic strip b type , full protractor 360o , half protractor 180o , geo-board rectangular , plastic box , connectors for strips , connectors t type , set square , rotating needle , scale , micro test tube , test tube holder , test tube stand , dropper with rubber bulb , glass rod and stirring rod , spatula , beaker 10 ml , funnel , dry cell holder , torch bulb with holder , beaker 50 ml , measuring cylinder 10 ml , w- tube , tripod , kerosene burner , laboratory stand , litmus paper , watch glass , china dish , ms rod , clamp , base plate , g-clamp , thermometer laboratory , ph paper , metals zn cu fe , emery paper and sand paper , iron nails , fe filings and zn dust , filter paper , micro test tube brush , dispensing bottle , vials , double mouthed flask , stop cock , pvc tube , micro filtration unit , copper electrodes , connecting wire , magnesium ribbon , cotton wool , wash bottle , pasteur pipette dropper , kit box along with carton , compound microscope , glass micro slides , washing brush , razor blade , micro test tubes , test tube holder , magnifying lens , watch glass , needles , forceps , blotting paper , test tube rack , surgical scissor , glass rod , cotton , muslin cloth , painting brush , measuring pan with holder , laboratory stand assembly , steel rod , boss head , assembly boiling tube with cork fitted glass tube , test tube 20ml , petridis , cover glasses , u clips , knife cutter , split cork , black paper , magnifying glass a type , a box of tooth pick , conical flask , permanent slides , parenchyma , collenchyma , sclerenchyma , epithelial tissue , striated muscles , smooth muscles , nerve cells , hydra budding , spirogya , binary fission in amoeba , hydra , j malarial parasite , showing life cycle , k some diseased plants , l binary fission in paramoecium , specimens , starfish , tape worm , mosquito lifecycle , silk moth , honeybee , cockroach , earthworm , ascaris , plastic boxes

Lactose Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

State Government